Rh6CG043200

F-box FBD LRR-repeat protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6C
OG0007537
Physical Location & Seq
Reverse (-)
4235471 .. 4237376
1906 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6CG043200.1

Sequence Viewer

Length: 294 bp
ATGGTCCGCCATGATGAAGACGACTTTGCTGGTGAAGAAGAAGCAGACTCTTGGTTGGATAACCTAGATGATCACATAAATTGCTCATTCCCCAATCTGCGACTTGTTGAAATAACCTGCTTTTCTGGTTGCAAAGCTGAATTAGATTTCATCAGATCTTTGCTTCTAAATTCACCTGTGCTTGAGACAATGACTGTTAGGGCTTTCTCTGCTGATGGTTCTTCAGAAGTTTTAAAGAAATTGCTCAAGTTAAGGCGTACCTCAAGTGCAGAGATTATATACTTGGATCCTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
F-box FBD LRR_2

Protein Analysis

97

Amino Acids

10.98

Weight (kDa)

4.49

Isoelectric Point (pI)

53.04

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
FBD PF08387 28 - 65 1.2e-06 FBD
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 125
AciI CCGC 1 cut(s) 7
AclWI GGATC 1 cut(s) 281
AcsI RAATTY 1 cut(s) 169
AcuI CTGAAG 1 cut(s) 207
AfaI GTAC 1 cut(s) 259
AgsI TTSAA 1 cut(s) 110
AluBI AGCT 1 cut(s) 137
AluI AGCT 1 cut(s) 137
Alw26I GTCTC 1 cut(s) 179
AlwI GGATC 1 cut(s) 281
ApoI RAATTY 1 cut(s) 169
AspS9I GGNCC 1 cut(s) 4
AsuHPI GGTGA 2 cut(s) 44, 165
AvaII GGWCC 1 cut(s) 4
BamHI GGATCC 1 cut(s) 286
BbsI GAAGAC 1 cut(s) 24
BccI CCATC 1 cut(s) 209
BclI TGATCA 1 cut(s) 70
BcoDI GTCTC 1 cut(s) 179
BfaI CTAG 1 cut(s) 65
BfuAI ACCTGC 1 cut(s) 125
BglII AGATCT 1 cut(s) 155
Bme18I GGWCC 1 cut(s) 4
BmgT120I GGNCC 1 cut(s) 4
BmiI GGNNCC 1 cut(s) 288
BpiI GAAGAC 1 cut(s) 24
BpuEI CTTGAG 3 cut(s) 203, 230, 247
BsgI GTGCAG 1 cut(s) 288
BsmAI GTCTC 1 cut(s) 179
Bsp143I GATC 3 cut(s) 70, 155, 286
BspACI CCGC 1 cut(s) 7
BspLI GGNNCC 1 cut(s) 288
BspMI ACCTGC 1 cut(s) 125
BspPI GGATC 1 cut(s) 281
BssMI GATC 3 cut(s) 70, 155, 286
Bst4CI ACNGT 1 cut(s) 196
BstKTI GATC 3 cut(s) 73, 158, 289
BstMAI GTCTC 1 cut(s) 179
BstMBI GATC 3 cut(s) 70, 155, 286
BstMWI GCNNNNNNNGC 1 cut(s) 209
BstV2I GAAGAC 1 cut(s) 24
BstX2I RGATCY 2 cut(s) 155, 286
BstYI RGATCY 2 cut(s) 155, 286
BveI ACCTGC 1 cut(s) 125
Cfr13I GGNCC 1 cut(s) 4
Csp6I GTAC 1 cut(s) 258
CviAII CATG 1 cut(s) 11
CviJI RGCY 2 cut(s) 137, 203
CviKI_1 RGCY 2 cut(s) 137, 203
CviQI GTAC 1 cut(s) 258
DpnI GATC 3 cut(s) 72, 157, 288
DpnII GATC 3 cut(s) 70, 155, 286
DraI TTTAAA 1 cut(s) 234
Eco47I GGWCC 1 cut(s) 4
Eco57I CTGAAG 1 cut(s) 207
FaeI CATG 1 cut(s) 14
FaiI YATR 4 cut(s) 12, 77, 278, 280
FatI CATG 1 cut(s) 10
FbaI TGATCA 1 cut(s) 70
FspBI CTAG 1 cut(s) 65
Hin1II CATG 1 cut(s) 14
HinfI GANTC 1 cut(s) 47
HphI GGTGA 2 cut(s) 44, 165
Hpy188I TCNGA 2 cut(s) 155, 226
HpyCH4III ACNGT 1 cut(s) 196
HpyCH4V TGCA 2 cut(s) 132, 269
HpyF10VI GCNNNNNNNGC 1 cut(s) 209
Hsp92II CATG 1 cut(s) 14
Ksp22I TGATCA 1 cut(s) 70
Kzo9I GATC 3 cut(s) 70, 155, 286
LpnPI CCDG 4 cut(s) 15, 111, 130, 189
MaeI CTAG 1 cut(s) 65
MalI GATC 3 cut(s) 72, 157, 288
MboI GATC 3 cut(s) 70, 155, 286
MboII GAAGA 4 cut(s) 29, 47, 50, 213
MflI RGATCY 2 cut(s) 155, 286
MluCI AATT 4 cut(s) 79, 140, 169, 239
MlyI GAGTC 1 cut(s) 41
MmeI TCCRAC 1 cut(s) 36
MnlI CCTC 1 cut(s) 271
MseI TTAA 2 cut(s) 233, 251
MwoI GCNNNNNNNGC 1 cut(s) 209
NdeII GATC 3 cut(s) 70, 155, 286
NlaIII CATG 1 cut(s) 14
NlaIV GGNNCC 1 cut(s) 288
PleI GAGTC 1 cut(s) 41
PpsI GAGTC 1 cut(s) 41
PspN4I GGNNCC 1 cut(s) 288
PspPI GGNCC 1 cut(s) 4
PsuI RGATCY 2 cut(s) 155, 286
RsaI GTAC 1 cut(s) 259
RsaNI GTAC 1 cut(s) 258
SaqAI TTAA 2 cut(s) 233, 251
Sau3AI GATC 3 cut(s) 70, 155, 286
Sau96I GGNCC 1 cut(s) 4
SchI GAGTC 1 cut(s) 41
SetI ASST 5 cut(s) 66, 119, 139, 178, 263
SinI GGWCC 1 cut(s) 4
SmlI CTYRAG 3 cut(s) 182, 245, 262
SmoI CTYRAG 3 cut(s) 182, 245, 262
Sse9I AATT 4 cut(s) 79, 140, 169, 239
SsiI CCGC 1 cut(s) 7
SspMI CTAG 1 cut(s) 65
TaaI ACNGT 1 cut(s) 196
TasI AATT 4 cut(s) 79, 140, 169, 239
Tru1I TTAA 2 cut(s) 233, 251
Tru9I TTAA 2 cut(s) 233, 251
TspDTI ATGAA 2 cut(s) 30, 139
VpaK11BI GGWCC 1 cut(s) 4
XapI RAATTY 1 cut(s) 169
XspI CTAG 1 cut(s) 65
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.