Rh6DG318100

Cupin-like domain

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6D
Physical Location & Seq
Forward (+)
52026827 .. 52027749
923 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6DG318100.1

Sequence Viewer

Length: 318 bp
ATGCGTCATGGCAAAGTGGTGAGGCTGCTAATGCTGATGCTTAAAAGTTTTCCAAGAACTTTGGAGGCTTTAATACTGCACATGCTTACACCAGTGGGAGCAGAAGTGCTTACACGTAAATTTGAAGAAATGGATGACCTGAACACCAAGGAAGATCGGAACAGATTTTACCAAGTTTTCTATGAATCATTCAACGACCAATTTGCTGCAATGGATGCAATTCTGAATGGAAAGGAATTATTTGCCCTCCAGGCATACAAGAATGTGTTAGATAAGAACATAGGAGTAGATTGGGGTGGGCCAAAACCAGTTGTGTGA

Protein Analysis

105

Amino Acids

12.15

Weight (kDa)

6.73

Isoelectric Point (pI)

27.2

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 119
AflIII ACRYGT 1 cut(s) 113
AgsI TTSAA 2 cut(s) 125, 193
AjnI CCWGG 1 cut(s) 249
AoxI GGCC 1 cut(s) 299
ApeKI GCWGC 2 cut(s) 25, 206
ApoI RAATTY 1 cut(s) 119
AspS9I GGNCC 1 cut(s) 299
AsuHPI GGTGA 1 cut(s) 31
BbvI GCAGC 2 cut(s) 12, 193
BcgI CGANNNNNNTGC 2 cut(s) 185, 219
BciT130I CCWGG 1 cut(s) 251
BglI GCCNNNNNGGC 1 cut(s) 251
BisI GCNGC 2 cut(s) 26, 207
BlsI GCNGC 2 cut(s) 27, 208
Bme1390I CCNGG 1 cut(s) 251
BmgT120I GGNCC 1 cut(s) 299
BmrFI CCNGG 1 cut(s) 251
BmsI GCATC 2 cut(s) 27, 205
BpmI CTGGAG 1 cut(s) 233
BsaAI YACGTR 1 cut(s) 116
BsaJI CCNNGG 1 cut(s) 147
BsaXI ACNNNNNCTCC 2 cut(s) 90, 120
Bse1I ACTGG 2 cut(s) 92, 308
Bse3DI GCAATG 1 cut(s) 216
BseBI CCWGG 1 cut(s) 251
BseDI CCNNGG 1 cut(s) 147
BseGI GGATG 2 cut(s) 139, 220
BseMI GCAATG 1 cut(s) 216
BseNI ACTGG 2 cut(s) 92, 308
BseXI GCAGC 2 cut(s) 12, 193
BsgI GTGCAG 1 cut(s) 62
BshFI GGCC 1 cut(s) 301
BsnI GGCC 1 cut(s) 301
Bsp143I GATC 1 cut(s) 154
BspANI GGCC 1 cut(s) 301
BsrDI GCAATG 1 cut(s) 216
BsrI ACTGG 2 cut(s) 92, 308
BssECI CCNNGG 1 cut(s) 147
BssMI GATC 1 cut(s) 154
BssT1I CCWWGG 1 cut(s) 147
Bst2UI CCWGG 1 cut(s) 251
BstAPI GCANNNNNTGC 1 cut(s) 215
BstBAI YACGTR 1 cut(s) 116
BstF5I GGATG 2 cut(s) 139, 220
BstKTI GATC 1 cut(s) 157
BstMBI GATC 1 cut(s) 154
BstMWI GCNNNNNNNGC 3 cut(s) 31, 215, 251
BstNI CCWGG 1 cut(s) 251
BstNSI RCATGY 1 cut(s) 85
BstSCI CCNGG 1 cut(s) 249
BstV1I GCAGC 2 cut(s) 12, 193
BsuRI GGCC 1 cut(s) 301
BtsCI GGATG 2 cut(s) 139, 220
BtsIMutI CAGTG 1 cut(s) 99
Cfr13I GGNCC 1 cut(s) 299
CviAII CATG 2 cut(s) 8, 82
CviJI RGCY 3 cut(s) 25, 68, 301
CviKI_1 RGCY 3 cut(s) 25, 68, 301
DpnI GATC 1 cut(s) 156
DpnII GATC 1 cut(s) 154
Eco130I CCWWGG 1 cut(s) 147
EcoRII CCWGG 1 cut(s) 249
EcoT14I CCWWGG 1 cut(s) 147
ErhI CCWWGG 1 cut(s) 147
FaeI CATG 2 cut(s) 11, 85
FaiI YATR 5 cut(s) 9, 83, 183, 256, 281
FatI CATG 2 cut(s) 7, 81
Fnu4HI GCNGC 2 cut(s) 26, 207
FokI GGATG 2 cut(s) 146, 227
Fsp4HI GCNGC 2 cut(s) 26, 207
GluI GCNGC 2 cut(s) 26, 207
GsuI CTGGAG 1 cut(s) 233
HaeIII GGCC 1 cut(s) 301
Hin1II CATG 2 cut(s) 11, 85
HinfI GANTC 1 cut(s) 185
HphI GGTGA 1 cut(s) 31
Hpy188I TCNGA 2 cut(s) 159, 225
HpyCH4IV ACGT 1 cut(s) 115
HpyCH4V TGCA 3 cut(s) 79, 209, 218
HpyF10VI GCNNNNNNNGC 3 cut(s) 31, 215, 251
HpySE526I ACGT 1 cut(s) 115
Hsp92II CATG 2 cut(s) 11, 85
Kzo9I GATC 1 cut(s) 154
LmnI GCTCC 1 cut(s) 98
LpnPI CCDG 4 cut(s) 105, 152, 236, 263
Lsp1109I GCAGC 2 cut(s) 12, 193
LweI GCATC 2 cut(s) 27, 205
MaeII ACGT 1 cut(s) 115
MalI GATC 1 cut(s) 156
MboI GATC 1 cut(s) 154
MboII GAAGA 2 cut(s) 137, 164
MluCI AATT 4 cut(s) 119, 200, 219, 236
MnlI CCTC 3 cut(s) 15, 58, 257
MseI TTAA 2 cut(s) 42, 71
MspR9I CCNGG 1 cut(s) 251
MvaI CCWGG 1 cut(s) 251
MwoI GCNNNNNNNGC 3 cut(s) 31, 215, 251
NdeII GATC 1 cut(s) 154
NlaIII CATG 2 cut(s) 11, 85
NspI RCATGY 1 cut(s) 85
PfeI GAWTC 1 cut(s) 185
PkrI GCNGC 2 cut(s) 27, 208
Ppu21I YACGTR 1 cut(s) 116
Psp6I CCWGG 1 cut(s) 249
PspGI CCWGG 1 cut(s) 249
PspPI GGNCC 1 cut(s) 299
PsrI GAACNNNNNNTAC 2 cut(s) 152, 184
SaqAI TTAA 2 cut(s) 42, 71
SatI GCNGC 2 cut(s) 26, 207
Sau3AI GATC 1 cut(s) 154
Sau96I GGNCC 1 cut(s) 299
ScrFI CCNGG 1 cut(s) 251
SetI ASST 2 cut(s) 118, 141
SfaNI GCATC 2 cut(s) 27, 205
Sse9I AATT 4 cut(s) 119, 200, 219, 236
StyD4I CCNGG 1 cut(s) 249
StyI CCWWGG 1 cut(s) 147
TaiI ACGT 1 cut(s) 118
TasI AATT 4 cut(s) 119, 200, 219, 236
TfiI GAWTC 1 cut(s) 185
Tru1I TTAA 2 cut(s) 42, 71
Tru9I TTAA 2 cut(s) 42, 71
TscAI CASTG 1 cut(s) 99
TseI GCWGC 2 cut(s) 25, 206
TspDTI ATGAA 1 cut(s) 198
TspRI CASTG 1 cut(s) 99
XapI RAATTY 1 cut(s) 119
XceI RCATGY 1 cut(s) 85
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.