Rh7CG310400

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7C
Physical Location & Seq
Forward (+)
32819816 .. 32832509
12694 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7CG310400.1

Sequence Viewer

Length: 315 bp
ATGCAGAAGTGGCCGGCGAGGAACAAGCAGTTCATCTCTGAGGTGAACGCCACCGATCCTAAACCTGAAACCGACTCGAACTCCGGCGCTGAGTCAGACTCGGACTCAAAATTGGGTTTGGAGTTTCCGAAAGCTATCAGGAGGACGAAGTCGGAGAAGTTCGAGAGAGTTGTTTCGGCAAAGCTAAAAAGGTCGGACAGTCCGGCGAGGAACAAGCAGTTCATCTCTGAGGTGAACGCCACCGATCCTAAACCTGAAACCGACTCGAACTCCGGCGCTGAGTCAGACTCGGACTCAAAATTGGCGACTGTATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

104

Amino Acids

11.44

Weight (kDa)

6.31

Isoelectric Point (pI)

61.07

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 50, 239
AcoI YGGCCR 1 cut(s) 11
AluBI AGCT 2 cut(s) 134, 184
AluI AGCT 2 cut(s) 134, 184
AlwI GGATC 2 cut(s) 50, 239
AoxI GGCC 1 cut(s) 11
AspLEI GCGC 2 cut(s) 89, 278
AsuHPI GGTGA 2 cut(s) 55, 244
BfoI RGCGCY 2 cut(s) 90, 279
BplI GAGNNNNNCTC 4 cut(s) 83, 115, 272, 304
BsaXI ACNNNNNCTCC 4 cut(s) 65, 95, 254, 284
Bse118I RCCGGY 1 cut(s) 13
BseMII CTCAG 4 cut(s) 30, 81, 219, 270
BshFI GGCC 1 cut(s) 13
BsiSI CCGG 4 cut(s) 14, 84, 203, 273
BsnI GGCC 1 cut(s) 13
Bsp143I GATC 2 cut(s) 55, 244
BspANI GGCC 1 cut(s) 13
BspCNI CTCAG 4 cut(s) 31, 82, 220, 271
BspPI GGATC 2 cut(s) 50, 239
BsrFI RCCGGY 1 cut(s) 13
BssAI RCCGGY 1 cut(s) 13
BssMI GATC 2 cut(s) 55, 244
Bst4CI ACNGT 2 cut(s) 200, 310
BstC8I GCNNGC 1 cut(s) 15
BstDEI CTNAG 4 cut(s) 39, 90, 228, 279
BstH2I RGCGCY 2 cut(s) 90, 279
BstHHI GCGC 2 cut(s) 89, 278
BstKTI GATC 2 cut(s) 58, 247
BstMBI GATC 2 cut(s) 55, 244
BstMWI GCNNNNNNNGC 1 cut(s) 10
BsuRI GGCC 1 cut(s) 13
Cac8I GCNNGC 1 cut(s) 15
CfoI GCGC 2 cut(s) 89, 278
Cfr10I RCCGGY 1 cut(s) 13
CviJI RGCY 3 cut(s) 13, 134, 184
CviKI_1 RGCY 3 cut(s) 13, 134, 184
DdeI CTNAG 4 cut(s) 39, 90, 228, 279
DpnI GATC 2 cut(s) 57, 246
DpnII GATC 2 cut(s) 55, 244
EaeI YGGCCR 1 cut(s) 11
FaiI YATR 1 cut(s) 313
GlaI GCGC 2 cut(s) 88, 277
HaeII RGCGCY 2 cut(s) 90, 279
HaeIII GGCC 1 cut(s) 13
HapII CCGG 4 cut(s) 14, 84, 203, 273
HhaI GCGC 2 cut(s) 89, 278
Hin6I GCGC 2 cut(s) 87, 276
HinP1I GCGC 2 cut(s) 87, 276
HinfI GANTC 8 cut(s) 74, 92, 98, 104, 263, 281, 287, 293
HpaII CCGG 4 cut(s) 14, 84, 203, 273
HphI GGTGA 2 cut(s) 55, 244
Hpy166II GTNNAC 2 cut(s) 46, 235
Hpy188I TCNGA 9 cut(s) 40, 97, 103, 129, 154, 196, 229, 286, 292
Hpy188III TCNNGA 2 cut(s) 139, 163
Hpy8I GTNNAC 2 cut(s) 46, 235
HpyCH4III ACNGT 2 cut(s) 200, 310
HpyCH4V TGCA 1 cut(s) 4
HpyF10VI GCNNNNNNNGC 1 cut(s) 10
HpyF3I CTNAG 4 cut(s) 39, 90, 228, 279
HspAI GCGC 2 cut(s) 87, 276
KroI GCCGGC 1 cut(s) 13
KroNI GCCGGC 1 cut(s) 15
Kzo9I GATC 2 cut(s) 55, 244
LpnPI CCDG 7 cut(s) 27, 78, 97, 124, 216, 267, 286
MalI GATC 2 cut(s) 57, 246
MboI GATC 2 cut(s) 55, 244
MluCI AATT 2 cut(s) 110, 299
MlyI GAGTC 8 cut(s) 68, 92, 98, 101, 257, 281, 287, 290
MmeI TCCRAC 2 cut(s) 132, 174
MnlI CCTC 5 cut(s) 12, 34, 135, 201, 223
MroNI GCCGGC 1 cut(s) 13
MspI CCGG 4 cut(s) 14, 84, 203, 273
MwoI GCNNNNNNNGC 1 cut(s) 10
NaeI GCCGGC 1 cut(s) 15
NdeII GATC 2 cut(s) 55, 244
NgoMIV GCCGGC 1 cut(s) 13
PdiI GCCGGC 1 cut(s) 15
PflFI GACNNNGTC 1 cut(s) 148
PleI GAGTC 8 cut(s) 68, 92, 98, 100, 257, 281, 287, 289
PpsI GAGTC 8 cut(s) 68, 92, 98, 100, 257, 281, 287, 289
PsyI GACNNNGTC 1 cut(s) 148
Sau3AI GATC 2 cut(s) 55, 244
SchI GAGTC 8 cut(s) 68, 92, 98, 101, 257, 281, 287, 290
SetI ASST 7 cut(s) 45, 67, 136, 186, 194, 234, 256
Sse9I AATT 2 cut(s) 110, 299
TaaI ACNGT 2 cut(s) 200, 310
TaqI TCGA 3 cut(s) 77, 162, 266
TasI AATT 2 cut(s) 110, 299
TspDTI ATGAA 2 cut(s) 22, 211
Tth111I GACNNNGTC 1 cut(s) 148
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.