Rh7DG128100

Cytochrome p450

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7D
Physical Location & Seq
Forward (+)
10784712 .. 10785065
354 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7DG128100.1

Sequence Viewer

Length: 354 bp
ATGCTGAGCACAACCTTCAACAACATACTTTCTAGGTGTGTTATTGGAAACAGGTTTGTAGAGGAAAATGATAATTGGTTTGGAGAGGCATCAAGAAGGTTGTTGGTTCAACTCACGGCTTTCAGTTTTGGAGATATCTTCCCTTGTTTGAGATGGATTGACAATCTTAGAGGATTCATTGCAAGTTTGAAAGCAACTTCTGCCAAATTAGATGGGTTCTTTGATCAGTTGATTGAAGAACACAAGACCACAAAGGCAGAAGGTATGCCCGAAACAAGTGATTTTGTGGATATTCTTGTCAAACTTCAAAAAGATGACATACTTAACTTGGATCTCACGCTCAAGACAACTTGA

Protein Analysis

117

Amino Acids

13.34

Weight (kDa)

4.9

Isoelectric Point (pI)

49.77

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 339
AgsI TTSAA 5 cut(s) 19, 110, 190, 236, 308
Alw21I GWGCWC 1 cut(s) 11
AlwI GGATC 1 cut(s) 339
Bbv12I GWGCWC 1 cut(s) 11
BccI CCATC 2 cut(s) 147, 206
BceAI ACGGC 1 cut(s) 132
BclI TGATCA 1 cut(s) 223
BfaI CTAG 1 cut(s) 33
BlpI GCTNAGC 1 cut(s) 5
BmsI GCATC 1 cut(s) 98
Bpu1102I GCTNAGC 1 cut(s) 5
BpuEI CTTGAG 1 cut(s) 326
Bse3DI GCAATG 1 cut(s) 177
BseMI GCAATG 1 cut(s) 177
BsiHKAI GWGCWC 1 cut(s) 11
Bsp1286I GDGCHC 1 cut(s) 11
Bsp143I GATC 2 cut(s) 223, 331
Bsp1720I GCTNAGC 1 cut(s) 5
BspPI GGATC 1 cut(s) 339
BsrDI GCAATG 1 cut(s) 177
BssMI GATC 2 cut(s) 223, 331
BstAPI GCANNNNNTGC 1 cut(s) 200
BstDEI CTNAG 2 cut(s) 5, 167
BstKTI GATC 2 cut(s) 226, 334
BstMBI GATC 2 cut(s) 223, 331
BstMWI GCNNNNNNNGC 1 cut(s) 200
BstX2I RGATCY 1 cut(s) 331
BstYI RGATCY 1 cut(s) 331
CviJI RGCY 1 cut(s) 119
CviKI_1 RGCY 1 cut(s) 119
DdeI CTNAG 2 cut(s) 5, 167
DpnI GATC 2 cut(s) 225, 333
DpnII GATC 2 cut(s) 223, 331
Eco32I GATATC 1 cut(s) 136
EcoRV GATATC 1 cut(s) 136
FaiI YATR 3 cut(s) 26, 266, 320
FbaI TGATCA 1 cut(s) 223
FspBI CTAG 1 cut(s) 33
HinfI GANTC 1 cut(s) 174
Hpy188III TCNNGA 2 cut(s) 93, 343
HpyAV CCTTC 3 cut(s) 25, 90, 254
HpyCH4V TGCA 1 cut(s) 182
HpyF10VI GCNNNNNNNGC 1 cut(s) 200
HpyF3I CTNAG 2 cut(s) 5, 167
Ksp22I TGATCA 1 cut(s) 223
Kzo9I GATC 2 cut(s) 223, 331
LpnPI CCDG 1 cut(s) 37
LweI GCATC 1 cut(s) 98
MaeI CTAG 1 cut(s) 33
MalI GATC 2 cut(s) 225, 333
MboI GATC 2 cut(s) 223, 331
MboII GAAGA 2 cut(s) 130, 248
MflI RGATCY 1 cut(s) 331
MhlI GDGCHC 1 cut(s) 11
MluCI AATT 2 cut(s) 73, 206
MnlI CCTC 3 cut(s) 55, 79, 164
MseI TTAA 1 cut(s) 324
MwoI GCNNNNNNNGC 1 cut(s) 200
NdeII GATC 2 cut(s) 223, 331
PfeI GAWTC 1 cut(s) 174
PsuI RGATCY 1 cut(s) 331
SaqAI TTAA 1 cut(s) 324
Sau3AI GATC 2 cut(s) 223, 331
SduI GDGCHC 1 cut(s) 11
SetI ASST 5 cut(s) 17, 38, 56, 101, 265
SfaNI GCATC 1 cut(s) 98
SmlI CTYRAG 1 cut(s) 341
SmoI CTYRAG 1 cut(s) 341
Sse9I AATT 2 cut(s) 73, 206
SspMI CTAG 1 cut(s) 33
TasI AATT 2 cut(s) 73, 206
TfiI GAWTC 1 cut(s) 174
Tru1I TTAA 1 cut(s) 324
Tru9I TTAA 1 cut(s) 324
TspDTI ATGAA 1 cut(s) 166
XspI CTAG 1 cut(s) 33
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.