Rh7DG202900
NAC Family

NAC domain-containing protein

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7D
Physical Location & Seq
Forward (+)
19201784 .. 19202242
459 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7DG202900.1

Sequence Viewer

Length: 459 bp
ATGCCTGTGCCTCCCCATCCTGATTCTTTTCTACAGCTCCCTCAATTAGAAAGCCCCAAGGTTTCTCAATATGGCACTTATGATCATCATAGGAACAATGGATGCCATGTAATGCCATCTTCGACATTCAGGCCAGATGAGCAATTGCAGCAGATGAATCAACAGAATCTCATGATCAACTCCTCACCACTACTTTATAATGACAACAGTCTTGATGATCAACTGACAGATTGGCGAGTTCTAGACAAATTTGTTGCATCACAGCTCAGCCATGACCAGCAAGAAGCTTCCAAGGAAACAACAACAAATTACTCAAATGAAGCAGTATTTGATCCTGTGGGTGATGAAGTACATATGAATATGGGAGCCAACGAATCCAAGAGGCCAGAAAATAATATTGGACAGGACTATGCCGCCTCAACATCCACATCAAGTTGCCAAATTGATCTGTGGAAGTGA

Protein Analysis

152

Amino Acids

17.24

Weight (kDa)

4.6

Isoelectric Point (pI)

64.51

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 198
AciI CCGC 1 cut(s) 414
AclWI GGATC 1 cut(s) 326
AcsI RAATTY 1 cut(s) 248
AfaI GTAC 1 cut(s) 351
AjuI GAANNNNNNNTTGG 2 cut(s) 381, 413
AluBI AGCT 3 cut(s) 37, 265, 287
AluI AGCT 3 cut(s) 37, 265, 287
AlwI GGATC 1 cut(s) 326
AoxI GGCC 2 cut(s) 131, 383
ApeKI GCWGC 1 cut(s) 148
ApoI RAATTY 1 cut(s) 248
AsuHPI GGTGA 2 cut(s) 177, 353
BbvI GCAGC 1 cut(s) 160
BccI CCATC 2 cut(s) 24, 124
BclI TGATCA 3 cut(s) 82, 174, 217
BfaI CTAG 1 cut(s) 242
BfmI CTRYAG 1 cut(s) 32
BisI GCNGC 2 cut(s) 149, 414
BlpI GCTNAGC 1 cut(s) 266
BlsI GCNGC 2 cut(s) 150, 415
BmiI GGNNCC 1 cut(s) 367
BmsI GCATC 2 cut(s) 92, 266
BoxI GACNNNNGTC 1 cut(s) 207
Bpu1102I GCTNAGC 1 cut(s) 266
BsaJI CCNNGG 2 cut(s) 57, 291
BseDI CCNNGG 2 cut(s) 57, 291
BseGI GGATG 3 cut(s) 16, 107, 422
BseMII CTCAG 1 cut(s) 280
BseRI GAGGAG 1 cut(s) 172
BseXI GCAGC 1 cut(s) 160
BshFI GGCC 2 cut(s) 133, 385
BsnI GGCC 2 cut(s) 133, 385
Bsp143I GATC 5 cut(s) 82, 174, 217, 331, 445
Bsp1720I GCTNAGC 1 cut(s) 266
BspACI CCGC 1 cut(s) 414
BspANI GGCC 2 cut(s) 133, 385
BspCNI CTCAG 1 cut(s) 279
BspHI TCATGA 1 cut(s) 171
BspLI GGNNCC 1 cut(s) 367
BspPI GGATC 1 cut(s) 326
BssECI CCNNGG 2 cut(s) 57, 291
BssMI GATC 5 cut(s) 82, 174, 217, 331, 445
BssT1I CCWWGG 2 cut(s) 57, 291
Bst4CI ACNGT 1 cut(s) 209
BstDEI CTNAG 1 cut(s) 266
BstF5I GGATG 3 cut(s) 16, 107, 422
BstKTI GATC 5 cut(s) 85, 177, 220, 334, 448
BstMBI GATC 5 cut(s) 82, 174, 217, 331, 445
BstMWI GCNNNNNNNGC 2 cut(s) 139, 148
BstPAI GACNNNNGTC 1 cut(s) 207
BstSFI CTRYAG 1 cut(s) 32
BstV1I GCAGC 1 cut(s) 160
BsuRI GGCC 2 cut(s) 133, 385
BtsCI GGATG 3 cut(s) 16, 107, 422
CciI TCATGA 1 cut(s) 171
Csp6I GTAC 1 cut(s) 350
CviAII CATG 3 cut(s) 107, 172, 272
CviJI RGCY 8 cut(s) 37, 54, 133, 265, 270, 287, 368, 385
CviKI_1 RGCY 8 cut(s) 37, 54, 133, 265, 270, 287, 368, 385
CviQI GTAC 1 cut(s) 350
DdeI CTNAG 1 cut(s) 266
DpnI GATC 5 cut(s) 84, 176, 219, 333, 447
DpnII GATC 5 cut(s) 82, 174, 217, 331, 445
Eco130I CCWWGG 2 cut(s) 57, 291
EcoT14I CCWWGG 2 cut(s) 57, 291
ErhI CCWWGG 2 cut(s) 57, 291
FaeI CATG 3 cut(s) 110, 175, 275
FatI CATG 3 cut(s) 106, 171, 271
FauNDI CATATG 1 cut(s) 354
FbaI TGATCA 3 cut(s) 82, 174, 217
Fnu4HI GCNGC 2 cut(s) 149, 414
FokI GGATG 3 cut(s) 3, 114, 409
Fsp4HI GCNGC 2 cut(s) 149, 414
FspBI CTAG 1 cut(s) 242
GluI GCNGC 2 cut(s) 149, 414
HaeIII GGCC 2 cut(s) 133, 385
Hin1II CATG 3 cut(s) 110, 175, 275
HindIII AAGCTT 1 cut(s) 285
HinfI GANTC 4 cut(s) 23, 157, 166, 374
HphI GGTGA 2 cut(s) 177, 353
Hpy188III TCNNGA 4 cut(s) 20, 172, 212, 242
HpyCH4III ACNGT 1 cut(s) 209
HpyCH4V TGCA 2 cut(s) 148, 257
HpyF10VI GCNNNNNNNGC 2 cut(s) 139, 148
HpyF3I CTNAG 1 cut(s) 266
Hsp92II CATG 3 cut(s) 110, 175, 275
Ksp22I TGATCA 3 cut(s) 82, 174, 217
Kzo9I GATC 5 cut(s) 82, 174, 217, 331, 445
LmnI GCTCC 2 cut(s) 42, 365
LpnPI CCDG 8 cut(s) 18, 33, 115, 147, 290, 348, 389, 399
Lsp1109I GCAGC 1 cut(s) 160
LweI GCATC 2 cut(s) 92, 266
MaeI CTAG 1 cut(s) 242
MalI GATC 5 cut(s) 84, 176, 219, 333, 447
MboI GATC 5 cut(s) 82, 174, 217, 331, 445
MboII GAAGA 1 cut(s) 111
MfeI CAATTG 1 cut(s) 143
MluCI AATT 5 cut(s) 44, 143, 248, 307, 441
MnlI CCTC 5 cut(s) 21, 51, 193, 375, 427
MunI CAATTG 1 cut(s) 143
MwoI GCNNNNNNNGC 2 cut(s) 139, 148
NdeI CATATG 1 cut(s) 354
NdeII GATC 5 cut(s) 82, 174, 217, 331, 445
NlaIII CATG 3 cut(s) 110, 175, 275
NlaIV GGNNCC 1 cut(s) 367
PagI TCATGA 1 cut(s) 171
PfeI GAWTC 4 cut(s) 23, 157, 166, 374
PkrI GCNGC 2 cut(s) 150, 415
PshAI GACNNNNGTC 1 cut(s) 207
PsiI TTATAA 1 cut(s) 198
PspN4I GGNNCC 1 cut(s) 367
RsaI GTAC 1 cut(s) 351
RsaNI GTAC 1 cut(s) 350
SatI GCNGC 2 cut(s) 149, 414
Sau3AI GATC 5 cut(s) 82, 174, 217, 331, 445
SetI ASST 4 cut(s) 39, 63, 267, 289
SfaNI GCATC 2 cut(s) 92, 266
SfcI CTRYAG 1 cut(s) 32
Sse9I AATT 5 cut(s) 44, 143, 248, 307, 441
SsiI CCGC 1 cut(s) 414
SspI AATATT 1 cut(s) 397
SspMI CTAG 1 cut(s) 242
StyI CCWWGG 2 cut(s) 57, 291
TaaI ACNGT 1 cut(s) 209
TaqI TCGA 1 cut(s) 122
TasI AATT 5 cut(s) 44, 143, 248, 307, 441
TatI WGTACW 1 cut(s) 349
TauI GCSGC 1 cut(s) 416
TfiI GAWTC 4 cut(s) 23, 157, 166, 374
TseI GCWGC 1 cut(s) 148
TspDTI ATGAA 4 cut(s) 170, 333, 360, 371
XapI RAATTY 1 cut(s) 248
XbaI TCTAGA 1 cut(s) 241
XspI CTAG 1 cut(s) 242
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.