AT1G15120

This is a component of the ubiquinol-cytochrome c reductase complex (complex III or cytochrome b-c1 complex), which is part of the mitochondrial respiratory chain. This protein may mediate formation of the complex between cytochromes c and c1

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
1
OG0005314
Physical Location & Seq
Forward (+)
5202593 .. 5204494
1902 bp
Loading structure...
UTR
Exon/CDS
Intron
AT1G15120.1

Sequence Viewer

Length: 210 bp
ATGGCAGATGATGAAGTTGTTGATCCAAAGAAGTACCTTGAGGAATCTTGCAAACCAAAATGTGTGAAGCCACTTCTCGAATATCAGGCATGTGTCAAGAGAATCCAAGGTGATGATTCTGGCCACAAGCATTGCACTGGCCAGTATTTTGACTACTGGCAATGCATTGACAAATGTGTTGCACCAAAGCTGTTTGCGAAACTAAAATGA

Protein Analysis

69

Amino Acids

7.98

Weight (kDa)

7.57

Isoelectric Point (pI)

30.96

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
UCR_hinge PF02320 8 - 69 4.3e-24 Ubiquinol-cytochrome C reductase hinge protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 17
AcoI YGGCCR 2 cut(s) 121, 139
AfaI GTAC 1 cut(s) 35
AluBI AGCT 1 cut(s) 190
AluI AGCT 1 cut(s) 190
AlwI GGATC 1 cut(s) 17
AoxI GGCC 2 cut(s) 121, 139
AsuHPI GGTGA 1 cut(s) 122
BalI TGGCCA 2 cut(s) 123, 141
BpuEI CTTGAG 1 cut(s) 59
BsaJI CCNNGG 1 cut(s) 106
Bse1I ACTGG 3 cut(s) 142, 142, 161
Bse3DI GCAATG 2 cut(s) 130, 167
BseDI CCNNGG 1 cut(s) 106
BseMI GCAATG 2 cut(s) 130, 167
BseNI ACTGG 3 cut(s) 142, 142, 161
BshFI GGCC 2 cut(s) 123, 141
BsnI GGCC 2 cut(s) 123, 141
Bsp143I GATC 1 cut(s) 22
BspANI GGCC 2 cut(s) 123, 141
BspPI GGATC 1 cut(s) 17
BsrDI GCAATG 2 cut(s) 130, 167
BsrI ACTGG 3 cut(s) 142, 142, 161
BssECI CCNNGG 1 cut(s) 106
BssMI GATC 1 cut(s) 22
BssT1I CCWWGG 1 cut(s) 106
BstKTI GATC 1 cut(s) 25
BstMBI GATC 1 cut(s) 22
BstNSI RCATGY 1 cut(s) 93
BsuRI GGCC 2 cut(s) 123, 141
BtsIMutI CAGTG 1 cut(s) 135
Csp6I GTAC 1 cut(s) 34
CspCI CAANNNNNGTGG 2 cut(s) 113, 148
CviAII CATG 1 cut(s) 90
CviJI RGCY 4 cut(s) 70, 123, 141, 190
CviKI_1 RGCY 4 cut(s) 70, 123, 141, 190
CviQI GTAC 1 cut(s) 34
DpnI GATC 1 cut(s) 24
DpnII GATC 1 cut(s) 22
EaeI YGGCCR 2 cut(s) 121, 139
Eco130I CCWWGG 1 cut(s) 106
EcoT14I CCWWGG 1 cut(s) 106
EcoT22I ATGCAT 1 cut(s) 167
ErhI CCWWGG 1 cut(s) 106
FaeI CATG 1 cut(s) 93
FaiI YATR 1 cut(s) 91
FatI CATG 1 cut(s) 89
HaeIII GGCC 2 cut(s) 123, 141
Hin1II CATG 1 cut(s) 93
HinfI GANTC 3 cut(s) 44, 102, 116
HphI GGTGA 1 cut(s) 122
Hpy188III TCNNGA 2 cut(s) 77, 97
HpyCH4V TGCA 4 cut(s) 51, 135, 165, 182
Hsp92II CATG 1 cut(s) 93
Kzo9I GATC 1 cut(s) 22
LpnPI CCDG 5 cut(s) 71, 105, 123, 142, 155
MalI GATC 1 cut(s) 24
MboI GATC 1 cut(s) 22
MlsI TGGCCA 2 cut(s) 123, 141
MluNI TGGCCA 2 cut(s) 123, 141
MnlI CCTC 1 cut(s) 34
Mox20I TGGCCA 2 cut(s) 123, 141
Mph1103I ATGCAT 1 cut(s) 167
MscI TGGCCA 2 cut(s) 123, 141
Msp20I TGGCCA 2 cut(s) 123, 141
NdeII GATC 1 cut(s) 22
NlaIII CATG 1 cut(s) 93
NsiI ATGCAT 1 cut(s) 167
NspI RCATGY 1 cut(s) 93
PfeI GAWTC 3 cut(s) 44, 102, 116
RsaI GTAC 1 cut(s) 35
RsaNI GTAC 1 cut(s) 34
Sau3AI GATC 1 cut(s) 22
SetI ASST 3 cut(s) 39, 112, 192
SmlI CTYRAG 1 cut(s) 38
SmoI CTYRAG 1 cut(s) 38
StyI CCWWGG 1 cut(s) 106
TaqI TCGA 1 cut(s) 78
TfiI GAWTC 3 cut(s) 44, 102, 116
TscAI CASTG 1 cut(s) 142
TspDTI ATGAA 1 cut(s) 27
TspRI CASTG 1 cut(s) 142
XceI RCATGY 1 cut(s) 93
Zsp2I ATGCAT 1 cut(s) 167
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.