MD05G1023300.v1.1

This is a component of the ubiquinol-cytochrome c reductase complex (complex III or cytochrome b-c1 complex), which is part of the mitochondrial respiratory chain. This protein may mediate formation of the complex between cytochromes c and c1

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr05
OG0005314
Physical Location & Seq
Reverse (-)
3892539 .. 3896016
3478 bp
Loading structure...
UTR
Exon/CDS
Intron
MD05G1023300.v1.1.491

Sequence Viewer

Length: 219 bp
ATGGATATACGGGCGGACGATGAACTTGTTGATCAAAAGAAGTATCTTGAGGAGTCTTGCCAGCCTAAATGTGTGAAGCCTCTGATTGAATATCAGGCATGTGTTAAGAGGGTTGAAGGTGACGACACTGGAAACAAGCATTGCACAGGGCAGTACTTTGACTACATATCTTGTGTTGACAAATGTGTTGCGCCAAAGTTATTTCAAAAGCTCAAATAA

Protein Analysis

73

Amino Acids

8.32

Weight (kDa)

5.73

Isoelectric Point (pI)

33.91

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
UCR_hinge PF02320 11 - 72 1e-22 Ubiquinol-cytochrome C reductase hinge protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 14
AfaI GTAC 1 cut(s) 155
AgsI TTSAA 3 cut(s) 89, 116, 206
AluBI AGCT 1 cut(s) 211
AluI AGCT 1 cut(s) 211
AspLEI GCGC 1 cut(s) 193
AsuHPI GGTGA 1 cut(s) 131
BclI TGATCA 1 cut(s) 31
BmcAI AGTACT 1 cut(s) 155
BpuEI CTTGAG 1 cut(s) 68
Bse1I ACTGG 1 cut(s) 133
Bse3DI GCAATG 1 cut(s) 139
BseMI GCAATG 1 cut(s) 139
BseNI ACTGG 1 cut(s) 133
BseRI GAGGAG 1 cut(s) 65
Bsp143I GATC 1 cut(s) 31
BspACI CCGC 1 cut(s) 14
BsrDI GCAATG 1 cut(s) 139
BsrI ACTGG 1 cut(s) 133
BssMI GATC 1 cut(s) 31
BstC8I GCNNGC 1 cut(s) 62
BstHHI GCGC 1 cut(s) 193
BstKTI GATC 1 cut(s) 34
BstMBI GATC 1 cut(s) 31
BstNSI RCATGY 1 cut(s) 102
BtsIMutI CAGTG 1 cut(s) 126
Cac8I GCNNGC 1 cut(s) 62
CfoI GCGC 1 cut(s) 193
Csp6I GTAC 1 cut(s) 154
CviAII CATG 1 cut(s) 99
CviJI RGCY 3 cut(s) 64, 79, 211
CviKI_1 RGCY 3 cut(s) 64, 79, 211
CviQI GTAC 1 cut(s) 154
DpnI GATC 1 cut(s) 33
DpnII GATC 1 cut(s) 31
EciI GGCGGA 1 cut(s) 29
FaeI CATG 1 cut(s) 102
FaiI YATR 3 cut(s) 8, 100, 167
FatI CATG 1 cut(s) 98
FbaI TGATCA 1 cut(s) 31
GlaI GCGC 1 cut(s) 192
HhaI GCGC 1 cut(s) 193
Hin1II CATG 1 cut(s) 102
Hin6I GCGC 1 cut(s) 191
HinP1I GCGC 1 cut(s) 191
HincII GTYRAC 1 cut(s) 178
HindII GTYRAC 1 cut(s) 178
HinfI GANTC 1 cut(s) 53
HphI GGTGA 1 cut(s) 131
Hpy166II GTNNAC 1 cut(s) 178
Hpy188I TCNGA 1 cut(s) 84
Hpy188III TCNNGA 1 cut(s) 47
Hpy8I GTNNAC 1 cut(s) 178
HpyAV CCTTC 1 cut(s) 110
HpyCH4V TGCA 1 cut(s) 144
Hsp92II CATG 1 cut(s) 102
HspAI GCGC 1 cut(s) 191
Ksp22I TGATCA 1 cut(s) 31
Kzo9I GATC 1 cut(s) 31
LpnPI CCDG 4 cut(s) 74, 80, 114, 132
MaeIII GTNAC 1 cut(s) 119
MalI GATC 1 cut(s) 33
MboI GATC 1 cut(s) 31
MlyI GAGTC 1 cut(s) 62
MnlI CCTC 3 cut(s) 43, 90, 102
MseI TTAA 1 cut(s) 105
NdeII GATC 1 cut(s) 31
NlaIII CATG 1 cut(s) 102
NmuCI GTSAC 1 cut(s) 119
NspI RCATGY 1 cut(s) 102
PleI GAGTC 1 cut(s) 61
PpsI GAGTC 1 cut(s) 61
RsaI GTAC 1 cut(s) 155
RsaNI GTAC 1 cut(s) 154
SaqAI TTAA 1 cut(s) 105
Sau3AI GATC 1 cut(s) 31
ScaI AGTACT 1 cut(s) 155
SchI GAGTC 1 cut(s) 62
SetI ASST 2 cut(s) 121, 213
SmlI CTYRAG 1 cut(s) 47
SmoI CTYRAG 1 cut(s) 47
SsiI CCGC 1 cut(s) 14
TatI WGTACW 1 cut(s) 153
Tru1I TTAA 1 cut(s) 105
Tru9I TTAA 1 cut(s) 105
TscAI CASTG 1 cut(s) 133
TseFI GTSAC 1 cut(s) 119
Tsp45I GTSAC 1 cut(s) 119
TspDTI ATGAA 1 cut(s) 36
TspRI CASTG 1 cut(s) 133
XceI RCATGY 1 cut(s) 102
ZrmI AGTACT 1 cut(s) 155
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.