Rorug07G0227900

This is a component of the ubiquinol-cytochrome c reductase complex (complex III or cytochrome b-c1 complex), which is part of the mitochondrial respiratory chain. This protein may mediate formation of the complex between cytochromes c and c1

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000007
OG0005314
Physical Location & Seq
Forward (+)
20833356 .. 20833694
339 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug07G0227900.1

Sequence Viewer

Length: 339 bp
ATGCAAGTGGAACTATTAGCAATTAGAGAAGGCCTAGACTTCCTCAAGCAGAGAGGCCTTCATGAGGTATGCCTTGAAAGTGACTGTCAAGGAGCGATCCAAGACATTGATATTGGGGACTATGACTTAAATGAAAACGCAAACCTGCTGCTCGACATTCAACAGTGTAGTAAGTTTGTGCATAATTTGAAATTCTCCTTTGCTCCTAGAACTGCCAGTTTTGTGGCACATAGGTTGGCAGCTTTTGCTTATGAATCCAATACTACTAATGTATGGATAGACCAAGCTCCAGTAAATATTCTGGATGCTATAGCTTCTGATTGTATTCGATCGAATTGA

Protein Analysis

112

Amino Acids

12.54

Weight (kDa)

4.55

Isoelectric Point (pI)

28.97

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
RVT_3 PF13456 2 - 83 9.9e-11 Reverse transcriptase-like
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 153
AclWI GGATC 1 cut(s) 91
AcsI RAATTY 1 cut(s) 191
AfiI CCNNNNNNNGG 1 cut(s) 64
AgsI TTSAA 3 cut(s) 77, 161, 190
AluBI AGCT 3 cut(s) 242, 287, 314
AluI AGCT 3 cut(s) 242, 287, 314
AlwI GGATC 1 cut(s) 91
AoxI GGCC 2 cut(s) 31, 55
ApeKI GCWGC 2 cut(s) 148, 239
ApoI RAATTY 1 cut(s) 191
BbvI GCAGC 2 cut(s) 135, 251
BfaI CTAG 2 cut(s) 35, 207
BfmI CTRYAG 1 cut(s) 309
BfuAI ACCTGC 1 cut(s) 153
BisI GCNGC 2 cut(s) 149, 240
BlsI GCNGC 2 cut(s) 150, 241
BmsI GCATC 1 cut(s) 295
BpmI CTGGAG 1 cut(s) 273
BpuEI CTTGAG 1 cut(s) 29
Bsc4I CCNNNNNNNGG 1 cut(s) 64
Bse1I ACTGG 2 cut(s) 216, 290
BseGI GGATG 1 cut(s) 310
BseLI CCNNNNNNNGG 1 cut(s) 64
BseNI ACTGG 2 cut(s) 216, 290
BseXI GCAGC 2 cut(s) 135, 251
Bsh1285I CGRYCG 1 cut(s) 332
BshFI GGCC 2 cut(s) 33, 57
BsiEI CGRYCG 1 cut(s) 332
BslFI GGGAC 1 cut(s) 131
BslI CCNNNNNNNGG 1 cut(s) 64
BsmFI GGGAC 1 cut(s) 131
BsnI GGCC 2 cut(s) 33, 57
Bsp143I GATC 2 cut(s) 96, 329
BspANI GGCC 2 cut(s) 33, 57
BspHI TCATGA 1 cut(s) 61
BspMI ACCTGC 1 cut(s) 153
BspPI GGATC 1 cut(s) 91
BsrI ACTGG 2 cut(s) 216, 290
BssMI GATC 2 cut(s) 96, 329
Bst4CI ACNGT 2 cut(s) 86, 165
BstAPI GCANNNNNTGC 1 cut(s) 245
BstENI CCTNNNNNAGG 1 cut(s) 62
BstF5I GGATG 1 cut(s) 310
BstKTI GATC 2 cut(s) 99, 332
BstMBI GATC 2 cut(s) 96, 329
BstMCI CGRYCG 1 cut(s) 332
BstMWI GCNNNNNNNGC 1 cut(s) 245
BstSFI CTRYAG 1 cut(s) 309
BstV1I GCAGC 2 cut(s) 135, 251
BstXI CCANNNNNNTGG 1 cut(s) 223
BsuRI GGCC 2 cut(s) 33, 57
BtsCI GGATG 1 cut(s) 310
BtsIMutI CAGTG 1 cut(s) 170
BveI ACCTGC 1 cut(s) 153
CciI TCATGA 1 cut(s) 61
CviAII CATG 1 cut(s) 62
CviJI RGCY 5 cut(s) 33, 57, 242, 287, 314
CviKI_1 RGCY 5 cut(s) 33, 57, 242, 287, 314
DpnI GATC 2 cut(s) 98, 331
DpnII GATC 2 cut(s) 96, 329
Eco147I AGGCCT 2 cut(s) 33, 57
EcoNI CCTNNNNNAGG 1 cut(s) 62
FaeI CATG 1 cut(s) 65
FaiI YATR 8 cut(s) 63, 70, 123, 183, 231, 252, 274, 311
FaqI GGGAC 1 cut(s) 131
FatI CATG 1 cut(s) 61
Fnu4HI GCNGC 2 cut(s) 149, 240
FokI GGATG 1 cut(s) 317
Fsp4HI GCNGC 2 cut(s) 149, 240
FspBI CTAG 2 cut(s) 35, 207
GluI GCNGC 2 cut(s) 149, 240
GsuI CTGGAG 1 cut(s) 273
HaeIII GGCC 2 cut(s) 33, 57
Hin1II CATG 1 cut(s) 65
HinfI GANTC 1 cut(s) 254
Hpy188I TCNGA 1 cut(s) 319
Hpy188III TCNNGA 2 cut(s) 62, 302
HpyAV CCTTC 2 cut(s) 23, 68
HpyCH4III ACNGT 2 cut(s) 86, 165
HpyCH4V TGCA 2 cut(s) 4, 181
HpyF10VI GCNNNNNNNGC 1 cut(s) 245
Hsp92II CATG 1 cut(s) 65
Kzo9I GATC 2 cut(s) 96, 329
LmnI GCTCC 3 cut(s) 92, 208, 292
LpnPI CCDG 4 cut(s) 158, 229, 287, 303
Lsp1109I GCAGC 2 cut(s) 135, 251
LweI GCATC 1 cut(s) 295
MaeI CTAG 2 cut(s) 35, 207
MaeIII GTNAC 1 cut(s) 80
MalI GATC 2 cut(s) 98, 331
MboI GATC 2 cut(s) 96, 329
MluCI AATT 4 cut(s) 21, 184, 191, 334
MnlI CCTC 3 cut(s) 47, 53, 58
MseI TTAA 1 cut(s) 128
MwoI GCNNNNNNNGC 1 cut(s) 245
NdeII GATC 2 cut(s) 96, 329
NlaIII CATG 1 cut(s) 65
NmuCI GTSAC 1 cut(s) 80
PagI TCATGA 1 cut(s) 61
PceI AGGCCT 2 cut(s) 33, 57
PfeI GAWTC 1 cut(s) 254
PkrI GCNGC 2 cut(s) 150, 241
Ple19I CGATCG 1 cut(s) 332
PvuI CGATCG 1 cut(s) 332
SaqAI TTAA 1 cut(s) 128
SatI GCNGC 2 cut(s) 149, 240
Sau3AI GATC 2 cut(s) 96, 329
SetI ASST 6 cut(s) 69, 147, 236, 244, 289, 316
SfaNI GCATC 1 cut(s) 295
SfcI CTRYAG 1 cut(s) 309
SmlI CTYRAG 1 cut(s) 44
SmoI CTYRAG 1 cut(s) 44
Sse9I AATT 4 cut(s) 21, 184, 191, 334
SseBI AGGCCT 2 cut(s) 33, 57
SspI AATATT 1 cut(s) 298
SspMI CTAG 2 cut(s) 35, 207
StuI AGGCCT 2 cut(s) 33, 57
TaaI ACNGT 2 cut(s) 86, 165
TaqI TCGA 3 cut(s) 153, 328, 332
TasI AATT 4 cut(s) 21, 184, 191, 334
TfiI GAWTC 1 cut(s) 254
Tru1I TTAA 1 cut(s) 128
Tru9I TTAA 1 cut(s) 128
TscAI CASTG 1 cut(s) 170
TseFI GTSAC 1 cut(s) 80
TseI GCWGC 2 cut(s) 148, 239
Tsp45I GTSAC 1 cut(s) 80
TspDTI ATGAA 3 cut(s) 50, 147, 267
TspRI CASTG 1 cut(s) 170
XagI CCTNNNNNAGG 1 cut(s) 62
XapI RAATTY 1 cut(s) 191
XspI CTAG 2 cut(s) 35, 207
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.