Rh1BG048500

This is a component of the ubiquinol-cytochrome c reductase complex (complex III or cytochrome b-c1 complex), which is part of the mitochondrial respiratory chain. This protein may mediate formation of the complex between cytochromes c and c1

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1B
OG0005314
Physical Location & Seq
Forward (+)
6662732 .. 6672845
10114 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1BG048500.1

Sequence Viewer

Length: 207 bp
ATGGCGGATGAGGAGATTGCTGATCCAAAAAAGTATCTGGAGGATTCTTGTCAACCTAAATGTGTGAAGCCTTTAATTGAATATCAGGCATGTGTCAAGAGGATTGAAGGTGATGATAGTGGTTACAAGCATTGTACTGGCCAGTACTTTGACTACATATCTTGTGTTGACAAATGTGTAAGTTATCATTTTATTAGAGCTATGTAA

Protein Analysis

68

Amino Acids

7.88

Weight (kDa)

5.18

Isoelectric Point (pI)

54.23

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
UCR_hinge PF02320 8 - 63 7.4e-17 Ubiquinol-cytochrome C reductase hinge protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 5
AclWI GGATC 1 cut(s) 17
AcoI YGGCCR 1 cut(s) 139
AfaI GTAC 2 cut(s) 136, 146
AgsI TTSAA 2 cut(s) 80, 107
AluBI AGCT 1 cut(s) 200
AluI AGCT 1 cut(s) 200
AlwI GGATC 1 cut(s) 17
AoxI GGCC 1 cut(s) 139
AsuHPI GGTGA 1 cut(s) 122
BalI TGGCCA 1 cut(s) 141
BmcAI AGTACT 1 cut(s) 146
BpmI CTGGAG 1 cut(s) 59
Bse1I ACTGG 2 cut(s) 142, 142
BseGI GGATG 1 cut(s) 13
BseNI ACTGG 2 cut(s) 142, 142
BseRI GAGGAG 1 cut(s) 26
BshFI GGCC 1 cut(s) 141
BsnI GGCC 1 cut(s) 141
Bsp143I GATC 1 cut(s) 22
BspACI CCGC 1 cut(s) 5
BspANI GGCC 1 cut(s) 141
BspPI GGATC 1 cut(s) 17
BsrI ACTGG 2 cut(s) 142, 142
BssMI GATC 1 cut(s) 22
BstF5I GGATG 1 cut(s) 13
BstKTI GATC 1 cut(s) 25
BstMBI GATC 1 cut(s) 22
BstNSI RCATGY 1 cut(s) 93
BsuRI GGCC 1 cut(s) 141
BtsCI GGATG 1 cut(s) 13
Csp6I GTAC 2 cut(s) 135, 145
CviAII CATG 1 cut(s) 90
CviJI RGCY 3 cut(s) 70, 141, 200
CviKI_1 RGCY 3 cut(s) 70, 141, 200
CviQI GTAC 2 cut(s) 135, 145
DpnI GATC 1 cut(s) 24
DpnII GATC 1 cut(s) 22
EaeI YGGCCR 1 cut(s) 139
EciI GGCGGA 1 cut(s) 20
FaeI CATG 1 cut(s) 93
FaiI YATR 3 cut(s) 91, 158, 203
FatI CATG 1 cut(s) 89
FokI GGATG 1 cut(s) 20
GsuI CTGGAG 1 cut(s) 59
HaeIII GGCC 1 cut(s) 141
Hin1II CATG 1 cut(s) 93
HincII GTYRAC 2 cut(s) 53, 169
HindII GTYRAC 2 cut(s) 53, 169
HinfI GANTC 1 cut(s) 44
HphI GGTGA 1 cut(s) 122
Hpy166II GTNNAC 2 cut(s) 53, 169
Hpy188III TCNNGA 2 cut(s) 38, 97
Hpy8I GTNNAC 2 cut(s) 53, 169
HpyAV CCTTC 1 cut(s) 101
Hsp92II CATG 1 cut(s) 93
Kzo9I GATC 1 cut(s) 22
LpnPI CCDG 4 cut(s) 23, 71, 123, 155
MaeIII GTNAC 1 cut(s) 122
MalI GATC 1 cut(s) 24
MboI GATC 1 cut(s) 22
MlsI TGGCCA 1 cut(s) 141
MluCI AATT 1 cut(s) 75
MluNI TGGCCA 1 cut(s) 141
MnlI CCTC 3 cut(s) 4, 34, 93
Mox20I TGGCCA 1 cut(s) 141
MscI TGGCCA 1 cut(s) 141
MseI TTAA 1 cut(s) 74
Msp20I TGGCCA 1 cut(s) 141
NdeII GATC 1 cut(s) 22
NlaIII CATG 1 cut(s) 93
NspI RCATGY 1 cut(s) 93
PfeI GAWTC 1 cut(s) 44
RsaI GTAC 2 cut(s) 136, 146
RsaNI GTAC 2 cut(s) 135, 145
SaqAI TTAA 1 cut(s) 74
Sau3AI GATC 1 cut(s) 22
ScaI AGTACT 1 cut(s) 146
SetI ASST 3 cut(s) 58, 112, 202
SgeI CNNG 9 cut(s) 50, 60, 98, 102, 109, 139, 150, 154, 174
Sse9I AATT 1 cut(s) 75
SsiI CCGC 1 cut(s) 5
TasI AATT 1 cut(s) 75
TatI WGTACW 2 cut(s) 134, 144
TfiI GAWTC 1 cut(s) 44
Tru1I TTAA 1 cut(s) 74
Tru9I TTAA 1 cut(s) 74
XceI RCATGY 1 cut(s) 93
ZrmI AGTACT 1 cut(s) 146
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.