AT1G43040

SAUR-like auxin-responsive protein family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
1
OG0002355
Physical Location & Seq
Forward (+)
16184038 .. 16184776
739 bp
Loading structure...
UTR
Exon/CDS
Intron
AT1G43040.1

Sequence Viewer

Length: 315 bp
ATGGTGAAGAAGCTACTATGTTGTGGAGCCAAGAGCTTCTCCCAAAGAGCTAGATTACCGGACGAAGGACGAGTCCGAGTTTATGTCGGAAACGATAGAGATACACAATGCAAGTTAGAGATGGATGCTGATTTCTTGACACATCCTTTGTTCGAGGATCTCCTCCGGTTATCCGAAGAAGAGTTTGGTCACTCATACGACGGTGCTTTAAGGATCGCCTGCGAGATACAAGTTTTTCTAAACTTGATCCATTACCTTAAGTCCACGAGTCATGCTCCTCATTATTATATTGATGCATCTCATTATCTTTATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko04075 map04075
Pfam Domains
Protein Families
Auxin_inducible

Protein Analysis

104

Amino Acids

12.08

Weight (kDa)

6.03

Isoelectric Point (pI)

38.93

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Auxin_inducible PF02519 14 - 85 1.7e-13 Auxin responsive protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 3 cut(s) 165, 221, 241
AfiI CCNNNNNNNGG 1 cut(s) 65
AflII CTTAAG 1 cut(s) 257
AjuI GAANNNNNNNTTGG 2 cut(s) 168, 200
AluBI AGCT 3 cut(s) 13, 36, 50
AluI AGCT 3 cut(s) 13, 36, 50
AlwI GGATC 3 cut(s) 165, 221, 241
ArsI GACNNNNNNTTYG 4 cut(s) 57, 89, 130, 162
AsuHPI GGTGA 1 cut(s) 16
BauI CACGAG 1 cut(s) 265
BccI CCATC 1 cut(s) 115
BfaI CTAG 1 cut(s) 51
BfrI CTTAAG 1 cut(s) 257
BmiI GGNNCC 1 cut(s) 28
BmsI GCATC 3 cut(s) 115, 283, 305
BplI GAGNNNNNCTC 2 cut(s) 259, 291
BsaWI WCCGGW 2 cut(s) 58, 165
Bsc4I CCNNNNNNNGG 1 cut(s) 65
BseGI GGATG 2 cut(s) 130, 142
BseLI CCNNNNNNNGG 1 cut(s) 65
BseRI GAGGAG 2 cut(s) 152, 267
BsiSI CCGG 2 cut(s) 59, 166
BslI CCNNNNNNNGG 1 cut(s) 65
Bsp143I GATC 3 cut(s) 157, 213, 246
BspLI GGNNCC 1 cut(s) 28
BspPI GGATC 3 cut(s) 165, 221, 241
BspTI CTTAAG 1 cut(s) 257
BssMI GATC 3 cut(s) 157, 213, 246
BssSI CACGAG 1 cut(s) 265
Bst2BI CACGAG 1 cut(s) 265
Bst4CI ACNGT 1 cut(s) 203
Bst6I CTCTTC 1 cut(s) 174
BstAFI CTTAAG 1 cut(s) 257
BstC8I GCNNGC 1 cut(s) 220
BstF5I GGATG 2 cut(s) 130, 142
BstKTI GATC 3 cut(s) 160, 216, 249
BstMBI GATC 3 cut(s) 157, 213, 246
BstX2I RGATCY 1 cut(s) 157
BstYI RGATCY 1 cut(s) 157
BtsCI GGATG 2 cut(s) 130, 142
Cac8I GCNNGC 1 cut(s) 220
CviAII CATG 1 cut(s) 272
CviJI RGCY 4 cut(s) 13, 29, 36, 50
CviKI_1 RGCY 4 cut(s) 13, 29, 36, 50
DpnI GATC 3 cut(s) 159, 215, 248
DpnII GATC 3 cut(s) 157, 213, 246
Eam1104I CTCTTC 1 cut(s) 174
EarI CTCTTC 1 cut(s) 174
EcoT22I ATGCAT 1 cut(s) 298
FaeI CATG 1 cut(s) 275
FaiI YATR 5 cut(s) 19, 84, 196, 273, 288
FatI CATG 1 cut(s) 271
FokI GGATG 2 cut(s) 129, 137
FspBI CTAG 1 cut(s) 51
HapII CCGG 2 cut(s) 59, 166
Hin1II CATG 1 cut(s) 275
HinfI GANTC 2 cut(s) 72, 268
HpaII CCGG 2 cut(s) 59, 166
HphI GGTGA 1 cut(s) 16
Hpy166II GTNNAC 1 cut(s) 264
Hpy188I TCNGA 3 cut(s) 77, 89, 175
Hpy188III TCNNGA 1 cut(s) 136
Hpy8I GTNNAC 1 cut(s) 264
Hpy99I CGWCG 1 cut(s) 203
HpyAV CCTTC 1 cut(s) 59
HpyCH4III ACNGT 1 cut(s) 203
HpyCH4V TGCA 2 cut(s) 111, 296
Hsp92II CATG 1 cut(s) 275
Kzo9I GATC 3 cut(s) 157, 213, 246
LmnI GCTCC 2 cut(s) 26, 280
LpnPI CCDG 3 cut(s) 72, 179, 232
LweI GCATC 3 cut(s) 115, 283, 305
MaeI CTAG 1 cut(s) 51
MaeIII GTNAC 1 cut(s) 188
MalI GATC 3 cut(s) 159, 215, 248
MboI GATC 3 cut(s) 157, 213, 246
MboII GAAGA 3 cut(s) 19, 188, 191
MflI RGATCY 1 cut(s) 157
MlyI GAGTC 2 cut(s) 81, 277
MmeI TCCRAC 1 cut(s) 67
MnlI CCTC 3 cut(s) 148, 173, 288
Mph1103I ATGCAT 1 cut(s) 298
MseI TTAA 2 cut(s) 209, 258
MspCI CTTAAG 1 cut(s) 257
MspI CCGG 2 cut(s) 59, 166
NdeII GATC 3 cut(s) 157, 213, 246
NlaIII CATG 1 cut(s) 275
NlaIV GGNNCC 1 cut(s) 28
NmuCI GTSAC 1 cut(s) 188
NsiI ATGCAT 1 cut(s) 298
PleI GAGTC 2 cut(s) 80, 276
PpsI GAGTC 2 cut(s) 80, 276
PspN4I GGNNCC 1 cut(s) 28
PsuI RGATCY 1 cut(s) 157
SaqAI TTAA 2 cut(s) 209, 258
Sau3AI GATC 3 cut(s) 157, 213, 246
SchI GAGTC 2 cut(s) 81, 277
SetI ASST 4 cut(s) 15, 38, 52, 258
SfaNI GCATC 3 cut(s) 115, 283, 305
SmlI CTYRAG 1 cut(s) 257
SmoI CTYRAG 1 cut(s) 257
SspMI CTAG 1 cut(s) 51
TaaI ACNGT 1 cut(s) 203
TaqI TCGA 1 cut(s) 153
Tru1I TTAA 2 cut(s) 209, 258
Tru9I TTAA 2 cut(s) 209, 258
TseFI GTSAC 1 cut(s) 188
Tsp45I GTSAC 1 cut(s) 188
Vha464I CTTAAG 1 cut(s) 257
XspI CTAG 1 cut(s) 51
Zsp2I ATGCAT 1 cut(s) 298
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.