Rmu_sc0000202.1_g000027

Auxin responsive protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000202.1
OG0002355
Physical Location & Seq
Forward (+)
111167 .. 111535
369 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000202.1_g000027.1.cds

Sequence Viewer

Length: 369 bp
atgatgatgagtagcattgtgaagaagtacttcttgttctgtggagcaaaggggtttccctcattctcagactgggacgactatcgagtagtgcctgtgccacaagccggtcaagtccgtgtgtacgttggaagagatattgacatgatgtgcaagttcgagatggaagccaattacctaaaccacccactcttccagagtctactggatctctccgccgagcaagagttcagttattcctacgatggagccctaagaatagggtgcgacgttgatctcttccactatcttcttggtctccttgaaaccagcaatccctccgcccattacatggagctttccgatctcatttccaagttctacagctag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko04075 map04075
Pfam Domains
Protein Families
Auxin_inducible

Protein Analysis

122

Amino Acids

14.06

Weight (kDa)

4.69

Isoelectric Point (pI)

42.04

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 331
AccI GTMKAC 1 cut(s) 202
AciI CCGC 2 cut(s) 216, 321
AclWI GGATC 1 cut(s) 216
AfaI GTAC 2 cut(s) 29, 125
AfiI CCNNNNNNNGG 2 cut(s) 107, 331
AgsI TTSAA 1 cut(s) 305
AluBI AGCT 2 cut(s) 337, 366
AluI AGCT 2 cut(s) 337, 366
Alw26I GTCTC 1 cut(s) 302
AlwI GGATC 1 cut(s) 216
Asp700I GAANNNNTTC 1 cut(s) 29
BanII GRGCYC 1 cut(s) 253
BccI CCATC 2 cut(s) 157, 239
BcoDI GTCTC 1 cut(s) 302
BfaI CTAG 1 cut(s) 367
BfmI CTRYAG 1 cut(s) 361
BmcAI AGTACT 1 cut(s) 29
BmiI GGNNCC 1 cut(s) 250
BmrI ACTGGG 1 cut(s) 82
BmuI ACTGGG 1 cut(s) 82
BsaI GGTCTC 1 cut(s) 302
Bsc4I CCNNNNNNNGG 2 cut(s) 107, 331
Bse118I RCCGGY 1 cut(s) 107
Bse1I ACTGG 2 cut(s) 77, 210
BseLI CCNNNNNNNGG 2 cut(s) 107, 331
BseMII CTCAG 1 cut(s) 81
BseNI ACTGG 2 cut(s) 77, 210
BsiSI CCGG 1 cut(s) 108
BslFI GGGAC 1 cut(s) 89
BslI CCNNNNNNNGG 2 cut(s) 107, 331
BsmAI GTCTC 1 cut(s) 302
BsmFI GGGAC 1 cut(s) 89
Bso31I GGTCTC 1 cut(s) 302
Bsp1286I GDGCHC 1 cut(s) 253
Bsp143I GATC 3 cut(s) 208, 274, 343
BspACI CCGC 2 cut(s) 216, 321
BspCNI CTCAG 1 cut(s) 80
BspLI GGNNCC 1 cut(s) 250
BspPI GGATC 1 cut(s) 216
BspTNI GGTCTC 1 cut(s) 302
BsrFI RCCGGY 1 cut(s) 107
BsrI ACTGG 2 cut(s) 77, 210
BssAI RCCGGY 1 cut(s) 107
BssMI GATC 3 cut(s) 208, 274, 343
Bst6I CTCTTC 3 cut(s) 127, 197, 284
BstDEI CTNAG 2 cut(s) 67, 254
BstKTI GATC 3 cut(s) 211, 277, 346
BstMAI GTCTC 1 cut(s) 302
BstMBI GATC 3 cut(s) 208, 274, 343
BstSFI CTRYAG 1 cut(s) 361
BstX2I RGATCY 1 cut(s) 208
BstYI RGATCY 1 cut(s) 208
Cfr10I RCCGGY 1 cut(s) 107
Csp6I GTAC 2 cut(s) 28, 124
CviAII CATG 2 cut(s) 145, 331
CviJI RGCY 5 cut(s) 107, 170, 251, 337, 366
CviKI_1 RGCY 5 cut(s) 107, 170, 251, 337, 366
CviQI GTAC 2 cut(s) 28, 124
DdeI CTNAG 2 cut(s) 67, 254
DpnI GATC 3 cut(s) 210, 276, 345
DpnII GATC 3 cut(s) 208, 274, 343
Eam1104I CTCTTC 3 cut(s) 127, 197, 284
EarI CTCTTC 3 cut(s) 127, 197, 284
EciI GGCGGA 2 cut(s) 205, 310
Eco24I GRGCYC 1 cut(s) 253
Eco31I GGTCTC 1 cut(s) 302
EcoT38I GRGCYC 1 cut(s) 253
FaeI CATG 2 cut(s) 148, 334
FaiI YATR 2 cut(s) 146, 332
FalI AAGNNNNNCTT 4 cut(s) 14, 46, 17, 49
FaqI GGGAC 1 cut(s) 89
FatI CATG 2 cut(s) 144, 330
FblI GTMKAC 1 cut(s) 202
FriOI GRGCYC 1 cut(s) 253
FspBI CTAG 1 cut(s) 367
HapII CCGG 1 cut(s) 108
Hin1II CATG 2 cut(s) 148, 334
HinfI GANTC 1 cut(s) 199
HpaII CCGG 1 cut(s) 108
Hpy166II GTNNAC 2 cut(s) 124, 203
Hpy188I TCNGA 2 cut(s) 70, 343
Hpy188III TCNNGA 2 cut(s) 160, 196
Hpy8I GTNNAC 2 cut(s) 124, 203
Hpy99I CGWCG 1 cut(s) 272
HpyCH4IV ACGT 2 cut(s) 126, 270
HpyCH4V TGCA 1 cut(s) 153
HpyF3I CTNAG 2 cut(s) 67, 254
HpySE526I ACGT 2 cut(s) 126, 270
Hsp92II CATG 2 cut(s) 148, 334
Kzo9I GATC 3 cut(s) 208, 274, 343
LmnI GCTCC 3 cut(s) 44, 248, 334
LpnPI CCDG 6 cut(s) 58, 108, 121, 191, 209, 322
MaeI CTAG 1 cut(s) 367
MaeII ACGT 2 cut(s) 126, 270
MalI GATC 3 cut(s) 210, 276, 345
MboI GATC 3 cut(s) 208, 274, 343
MboII GAAGA 5 cut(s) 34, 144, 184, 271, 281
MflI RGATCY 1 cut(s) 208
MhlI GDGCHC 1 cut(s) 253
MluCI AATT 1 cut(s) 172
MlyI GAGTC 1 cut(s) 208
MmeI TCCRAC 1 cut(s) 109
MnlI CCTC 2 cut(s) 70, 328
MroXI GAANNNNTTC 1 cut(s) 29
MspI CCGG 1 cut(s) 108
NdeII GATC 3 cut(s) 208, 274, 343
NlaIII CATG 2 cut(s) 148, 334
NlaIV GGNNCC 1 cut(s) 250
NmeAIII GCCGAG 1 cut(s) 244
PdmI GAANNNNTTC 1 cut(s) 29
PflMI CCANNNNNTGG 1 cut(s) 331
PleI GAGTC 1 cut(s) 207
PpsI GAGTC 1 cut(s) 207
PspN4I GGNNCC 1 cut(s) 250
PsrI GAACNNNNNNTAC 2 cut(s) 20, 52
PsuI RGATCY 1 cut(s) 208
RsaI GTAC 2 cut(s) 29, 125
RsaNI GTAC 2 cut(s) 28, 124
Sau3AI GATC 3 cut(s) 208, 274, 343
ScaI AGTACT 1 cut(s) 29
SchI GAGTC 1 cut(s) 208
SduI GDGCHC 1 cut(s) 253
SetI ASST 5 cut(s) 129, 180, 273, 339, 368
SfcI CTRYAG 1 cut(s) 361
Sse9I AATT 1 cut(s) 172
SsiI CCGC 2 cut(s) 216, 321
SspMI CTAG 1 cut(s) 367
TaiI ACGT 2 cut(s) 129, 273
TaqI TCGA 2 cut(s) 85, 159
TasI AATT 1 cut(s) 172
TatI WGTACW 1 cut(s) 27
TspGWI ACGGA 1 cut(s) 107
Van91I CCANNNNNTGG 1 cut(s) 331
XcmI CCANNNNNNNNNTGG 1 cut(s) 290
XmiI GTMKAC 1 cut(s) 202
XmnI GAANNNNTTC 1 cut(s) 29
XspI CTAG 1 cut(s) 367
ZrmI AGTACT 1 cut(s) 29
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.