AT2G30000

PHD finger-like domain-containing protein

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
2
Physical Location & Seq
Reverse (-)
12803823 .. 12805024
1202 bp
Loading structure...
UTR
Exon/CDS
Intron
AT2G30000.1

Sequence Viewer

Length: 333 bp
ATGGCGAAGCATCACCCTGATTTGATCATGTGCCGGAAACAACCCGGAATTGCTATTGGACGACTGTGTGAGAAATGCGATGGGAAATGCGTGATTTGTGATTCTTATGTGCGTCCGTGTACTCTAGTACGTATTTGTGATGAATGCAACTACGGGTCATTCCAAGGTCGGTGTGTTATATGCGGTGGCGTTGGAATCTCAGATGCTTATTACTGCAAAGAGTGTACACAGCAGGAGAAAGACAGAGATGGTTGCCCCAAGATTGTTAACCTTGGCAGTGCGAAAACCGATCTCTTCTATGAACGCAAGAAATACGGATTCAAAAAACGATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

110

Amino Acids

12.43

Weight (kDa)

8.79

Isoelectric Point (pI)

38.42

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PHF5 PF03660 1 - 104 4e-50 PHF5-like protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 183
AfaI GTAC 3 cut(s) 121, 129, 226
AgsI TTSAA 1 cut(s) 322
AsuC2I CCSGG 1 cut(s) 45
AsuHPI GGTGA 1 cut(s) 5
BccI CCATC 2 cut(s) 74, 242
BclI TGATCA 1 cut(s) 24
BcnI CCSGG 1 cut(s) 45
BfaI CTAG 1 cut(s) 125
Bme1390I CCNGG 1 cut(s) 45
BmrFI CCNGG 1 cut(s) 45
BmsI GCATC 2 cut(s) 19, 193
BpuMI CCSGG 1 cut(s) 45
BsaAI YACGTR 1 cut(s) 131
BsaJI CCNNGG 2 cut(s) 163, 271
BseDI CCNNGG 2 cut(s) 163, 271
BseMII CTCAG 1 cut(s) 213
BsiSI CCGG 2 cut(s) 34, 45
BsmI GAATGC 1 cut(s) 149
Bsp1407I TGTACA 1 cut(s) 224
Bsp143I GATC 2 cut(s) 24, 289
BspACI CCGC 1 cut(s) 183
BspCNI CTCAG 1 cut(s) 212
BsrGI TGTACA 1 cut(s) 224
BssECI CCNNGG 2 cut(s) 163, 271
BssMI GATC 2 cut(s) 24, 289
BssT1I CCWWGG 2 cut(s) 163, 271
Bst4CI ACNGT 1 cut(s) 66
Bst6I CTCTTC 1 cut(s) 299
BstAUI TGTACA 1 cut(s) 224
BstBAI YACGTR 1 cut(s) 131
BstDEI CTNAG 1 cut(s) 199
BstKTI GATC 2 cut(s) 27, 292
BstMBI GATC 2 cut(s) 24, 289
BstSCI CCNGG 1 cut(s) 43
BstSNI TACGTA 1 cut(s) 131
BtgZI GCGATG 1 cut(s) 93
BtsI GCAGTG 1 cut(s) 283
BtsIMutI CAGTG 1 cut(s) 283
CseI GACGC 1 cut(s) 101
Csp6I GTAC 3 cut(s) 120, 128, 225
CviAII CATG 1 cut(s) 28
CviQI GTAC 3 cut(s) 120, 128, 225
DdeI CTNAG 1 cut(s) 199
DpnI GATC 2 cut(s) 26, 291
DpnII GATC 2 cut(s) 24, 289
Eam1104I CTCTTC 1 cut(s) 299
EarI CTCTTC 1 cut(s) 299
Eco105I TACGTA 1 cut(s) 131
Eco130I CCWWGG 2 cut(s) 163, 271
EcoT14I CCWWGG 2 cut(s) 163, 271
ErhI CCWWGG 2 cut(s) 163, 271
FaeI CATG 1 cut(s) 31
FaiI YATR 5 cut(s) 29, 108, 179, 181, 300
FatI CATG 1 cut(s) 27
FbaI TGATCA 1 cut(s) 24
FspBI CTAG 1 cut(s) 125
HapII CCGG 2 cut(s) 34, 45
HgaI GACGC 1 cut(s) 101
Hin1II CATG 1 cut(s) 31
HincII GTYRAC 1 cut(s) 268
HindII GTYRAC 1 cut(s) 268
HinfI GANTC 3 cut(s) 101, 195, 318
HpaI GTTAAC 1 cut(s) 268
HpaII CCGG 2 cut(s) 34, 45
HphI GGTGA 1 cut(s) 5
Hpy166II GTNNAC 4 cut(s) 120, 225, 227, 268
Hpy188I TCNGA 1 cut(s) 202
Hpy8I GTNNAC 4 cut(s) 120, 225, 227, 268
HpyCH4III ACNGT 1 cut(s) 66
HpyCH4IV ACGT 1 cut(s) 130
HpyCH4V TGCA 2 cut(s) 147, 216
HpyF3I CTNAG 1 cut(s) 199
HpySE526I ACGT 1 cut(s) 130
Hsp92II CATG 1 cut(s) 31
Ksp22I TGATCA 1 cut(s) 24
KspAI GTTAAC 1 cut(s) 268
Kzo9I GATC 2 cut(s) 24, 289
LpnPI CCDG 4 cut(s) 30, 47, 58, 218
LweI GCATC 2 cut(s) 19, 193
MaeI CTAG 1 cut(s) 125
MaeII ACGT 1 cut(s) 130
MalI GATC 2 cut(s) 26, 291
MboI GATC 2 cut(s) 24, 289
MboII GAAGA 1 cut(s) 286
MluCI AATT 1 cut(s) 48
MmeI TCCRAC 1 cut(s) 172
MseI TTAA 1 cut(s) 267
MspI CCGG 2 cut(s) 34, 45
MspR9I CCNGG 1 cut(s) 45
Mva1269I GAATGC 1 cut(s) 149
NciI CCSGG 1 cut(s) 45
NdeII GATC 2 cut(s) 24, 289
NlaIII CATG 1 cut(s) 31
PctI GAATGC 1 cut(s) 149
PfeI GAWTC 3 cut(s) 101, 195, 318
Ppu21I YACGTR 1 cut(s) 131
RsaI GTAC 3 cut(s) 121, 129, 226
RsaNI GTAC 3 cut(s) 120, 128, 225
SaqAI TTAA 1 cut(s) 267
Sau3AI GATC 2 cut(s) 24, 289
ScrFI CCNGG 1 cut(s) 45
SetI ASST 3 cut(s) 133, 169, 273
SfaNI GCATC 2 cut(s) 19, 193
SnaBI TACGTA 1 cut(s) 131
Sse9I AATT 1 cut(s) 48
SsiI CCGC 1 cut(s) 183
SspMI CTAG 1 cut(s) 125
StyD4I CCNGG 1 cut(s) 43
StyI CCWWGG 2 cut(s) 163, 271
TaaI ACNGT 1 cut(s) 66
TaiI ACGT 1 cut(s) 133
TasI AATT 1 cut(s) 48
TatI WGTACW 2 cut(s) 119, 224
TfiI GAWTC 3 cut(s) 101, 195, 318
Tru1I TTAA 1 cut(s) 267
Tru9I TTAA 1 cut(s) 267
TscAI CASTG 1 cut(s) 283
TspDTI ATGAA 2 cut(s) 156, 315
TspGWI ACGGA 2 cut(s) 105, 330
TspRI CASTG 1 cut(s) 283
XspI CTAG 1 cut(s) 125
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.