AT4G02482

Translocase of chloroplast 159

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
4
Physical Location & Seq
Forward (+)
1092012 .. 1092610
599 bp
Loading structure...
UTR
Exon/CDS
Intron
AT4G02482.1

Sequence Viewer

Length: 201 bp
ATGGGAGTGTCTCTAAAAAATTCGAAAGATGATTTAACAGTCACAGCCAATCTACGACATCAAGTCTCTGTGGGAAGACAGACAAAGGTAACAACTTTTGTAAGTCTTGACAGCAAGAGGACCGGGTGTTTCACTGTCCGAACAAACAGCTCAGATCAGTTGCAGATTGCTGTCATGGCTCTGCTTCTCCTTGCCATGTGA

Protein Analysis

66

Amino Acids

7.2

Weight (kDa)

10.02

Isoelectric Point (pI)

26.92

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
TOC159_MAD PF11886 2 - 65 2e-15 Translocase of chloroplast 159/132, membrane anchor domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 19
AhdI GACNNNNNGTC 1 cut(s) 62
AluBI AGCT 1 cut(s) 150
AluI AGCT 1 cut(s) 150
Alw26I GTCTC 2 cut(s) 15, 70
ApoI RAATTY 1 cut(s) 19
AspS9I GGNCC 1 cut(s) 120
AsuC2I CCSGG 1 cut(s) 124
AsuII TTCGAA 1 cut(s) 23
AvaII GGWCC 1 cut(s) 120
BbsI GAAGAC 1 cut(s) 82
BcnI CCSGG 1 cut(s) 124
BcoDI GTCTC 2 cut(s) 15, 70
Bme1390I CCNGG 1 cut(s) 124
Bme18I GGWCC 1 cut(s) 120
BmeRI GACNNNNNGTC 1 cut(s) 62
BmgT120I GGNCC 1 cut(s) 120
BmrFI CCNGG 1 cut(s) 124
BpiI GAAGAC 1 cut(s) 82
Bpu14I TTCGAA 1 cut(s) 23
BpuMI CCSGG 1 cut(s) 124
BseMII CTCAG 1 cut(s) 165
BsiSI CCGG 1 cut(s) 123
BsmAI GTCTC 2 cut(s) 15, 70
Bsp119I TTCGAA 1 cut(s) 23
Bsp143I GATC 1 cut(s) 154
BspCNI CTCAG 1 cut(s) 164
BspT104I TTCGAA 1 cut(s) 23
BssMI GATC 1 cut(s) 154
Bst4CI ACNGT 2 cut(s) 40, 136
BstBI TTCGAA 1 cut(s) 23
BstDEI CTNAG 1 cut(s) 151
BstKTI GATC 1 cut(s) 157
BstMAI GTCTC 2 cut(s) 15, 70
BstMBI GATC 1 cut(s) 154
BstMWI GCNNNNNNNGC 1 cut(s) 176
BstSCI CCNGG 1 cut(s) 122
BstV2I GAAGAC 1 cut(s) 82
BtsIMutI CAGTG 1 cut(s) 132
Cfr13I GGNCC 1 cut(s) 120
CviAII CATG 2 cut(s) 175, 196
CviJI RGCY 3 cut(s) 47, 150, 179
CviKI_1 RGCY 3 cut(s) 47, 150, 179
DdeI CTNAG 1 cut(s) 151
DpnI GATC 1 cut(s) 156
DpnII GATC 1 cut(s) 154
DriI GACNNNNNGTC 1 cut(s) 62
Eam1105I GACNNNNNGTC 1 cut(s) 62
Eco47I GGWCC 1 cut(s) 120
FaeI CATG 2 cut(s) 178, 199
FaiI YATR 2 cut(s) 176, 197
FatI CATG 2 cut(s) 174, 195
HapII CCGG 1 cut(s) 123
Hin1II CATG 2 cut(s) 178, 199
HpaII CCGG 1 cut(s) 123
Hpy188I TCNGA 2 cut(s) 140, 154
Hpy188III TCNNGA 1 cut(s) 107
HpyCH4III ACNGT 2 cut(s) 40, 136
HpyCH4V TGCA 1 cut(s) 163
HpyF10VI GCNNNNNNNGC 1 cut(s) 176
HpyF3I CTNAG 1 cut(s) 151
Hsp92II CATG 2 cut(s) 178, 199
Kzo9I GATC 1 cut(s) 154
LpnPI CCDG 1 cut(s) 136
MaeIII GTNAC 2 cut(s) 40, 88
MalI GATC 1 cut(s) 156
MboI GATC 1 cut(s) 154
MboII GAAGA 1 cut(s) 87
MluCI AATT 1 cut(s) 19
MnlI CCTC 1 cut(s) 111
MseI TTAA 1 cut(s) 35
MspI CCGG 1 cut(s) 123
MspR9I CCNGG 1 cut(s) 124
MwoI GCNNNNNNNGC 1 cut(s) 176
NciI CCSGG 1 cut(s) 124
NdeII GATC 1 cut(s) 154
NlaIII CATG 2 cut(s) 178, 199
NmuCI GTSAC 1 cut(s) 40
NspV TTCGAA 1 cut(s) 23
PspPI GGNCC 1 cut(s) 120
SaqAI TTAA 1 cut(s) 35
Sau3AI GATC 1 cut(s) 154
Sau96I GGNCC 1 cut(s) 120
ScrFI CCNGG 1 cut(s) 124
SetI ASST 2 cut(s) 90, 152
SfuI TTCGAA 1 cut(s) 23
SgeI CNNG 6 cut(s) 74, 119, 127, 135, 136, 187
SinI GGWCC 1 cut(s) 120
Sse9I AATT 1 cut(s) 19
StyD4I CCNGG 1 cut(s) 122
TaaI ACNGT 2 cut(s) 40, 136
TaqI TCGA 1 cut(s) 23
TasI AATT 1 cut(s) 19
Tru1I TTAA 1 cut(s) 35
Tru9I TTAA 1 cut(s) 35
TscAI CASTG 1 cut(s) 139
TseFI GTSAC 1 cut(s) 40
Tsp45I GTSAC 1 cut(s) 40
TspRI CASTG 1 cut(s) 139
VpaK11BI GGWCC 1 cut(s) 120
XapI RAATTY 1 cut(s) 19
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.