AT5G57815

This protein is one of the nuclear-coded polypeptide chains of cytochrome c oxidase, the terminal oxidase in mitochondrial electron transport

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
5
Physical Location & Seq
Forward (+)
23426647 .. 23427911
1265 bp
Loading structure...
UTR
Exon/CDS
Intron
AT5G57815.1

Sequence Viewer

Length: 237 bp
ATGGAAGACGAGATTGAATTGAAAACTGCTCCTGCTGATTTCCGGTTTCCTACAACAAATCAAACTAGGCACTGCTTCACTCGGTACATCGAGTTTCACAGGTGTACAACTGCAAAGGGAGAGGAGTCTAATGACTGTGAAAGGTTTGCCAAGTATTACCGTGCCCTCTGTCCTGGAGAATGGGTTGACAAGTGGAACGAGCAGAGGGAGAGTGGAACTTTTCCAGGTCCTCTTTGA

Protein Analysis

78

Amino Acids

9.25

Weight (kDa)

5.33

Isoelectric Point (pI)

42.09

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
COX6B PF02297 15 - 75 9.5e-22 Cytochrome oxidase c subunit VIb
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 2 cut(s) 86, 106
AgsI TTSAA 2 cut(s) 17, 22
AjnI CCWGG 2 cut(s) 172, 223
AspS9I GGNCC 1 cut(s) 227
AvaII GGWCC 1 cut(s) 227
BaeGI GKGCMC 1 cut(s) 166
BbsI GAAGAC 1 cut(s) 12
BciT130I CCWGG 2 cut(s) 174, 225
BfaI CTAG 1 cut(s) 66
Bme1390I CCNGG 2 cut(s) 174, 225
Bme18I GGWCC 1 cut(s) 227
BmgT120I GGNCC 1 cut(s) 227
BmrFI CCNGG 2 cut(s) 174, 225
BpiI GAAGAC 1 cut(s) 12
BpmI CTGGAG 1 cut(s) 195
BsaWI WCCGGW 1 cut(s) 42
BsaXI ACNNNNNCTCC 2 cut(s) 168, 198
BseBI CCWGG 2 cut(s) 174, 225
BseRI GAGGAG 1 cut(s) 137
BseSI GKGCMC 1 cut(s) 166
BsiSI CCGG 1 cut(s) 43
Bsp1286I GDGCHC 1 cut(s) 166
Bsp1407I TGTACA 1 cut(s) 104
BsrGI TGTACA 1 cut(s) 104
Bst2UI CCWGG 2 cut(s) 174, 225
Bst4CI ACNGT 2 cut(s) 137, 161
BstAUI TGTACA 1 cut(s) 104
BstNI CCWGG 2 cut(s) 174, 225
BstSCI CCNGG 2 cut(s) 172, 223
BstSLI GKGCMC 1 cut(s) 166
BstV2I GAAGAC 1 cut(s) 12
BtsI GCAGTG 1 cut(s) 70
BtsIMutI CAGTG 1 cut(s) 70
Cfr13I GGNCC 1 cut(s) 227
Csp6I GTAC 2 cut(s) 85, 105
CviQI GTAC 2 cut(s) 85, 105
Eco47I GGWCC 1 cut(s) 227
EcoO109I RGGNCCY 1 cut(s) 227
EcoRII CCWGG 2 cut(s) 172, 223
FspBI CTAG 1 cut(s) 66
GsuI CTGGAG 1 cut(s) 195
HapII CCGG 1 cut(s) 43
HincII GTYRAC 1 cut(s) 187
HindII GTYRAC 1 cut(s) 187
HinfI GANTC 1 cut(s) 125
HpaII CCGG 1 cut(s) 43
Hpy166II GTNNAC 2 cut(s) 105, 187
Hpy8I GTNNAC 2 cut(s) 105, 187
HpyCH4III ACNGT 2 cut(s) 137, 161
HpyCH4V TGCA 1 cut(s) 113
LmnI GCTCC 1 cut(s) 34
LpnPI CCDG 6 cut(s) 45, 56, 85, 159, 186, 210
MaeI CTAG 1 cut(s) 66
MboII GAAGA 1 cut(s) 17
MhlI GDGCHC 1 cut(s) 166
MluCI AATT 1 cut(s) 17
MlyI GAGTC 1 cut(s) 134
MnlI CCTC 3 cut(s) 115, 176, 198
MspI CCGG 1 cut(s) 43
MspR9I CCNGG 2 cut(s) 174, 225
MvaI CCWGG 2 cut(s) 174, 225
PfoI TCCNGGA 1 cut(s) 172
PleI GAGTC 1 cut(s) 133
PpsI GAGTC 1 cut(s) 133
PpuMI RGGWCCY 1 cut(s) 227
Psp5II RGGWCCY 1 cut(s) 227
Psp6I CCWGG 2 cut(s) 172, 223
PspGI CCWGG 2 cut(s) 172, 223
PspPI GGNCC 1 cut(s) 227
PspPPI RGGWCCY 1 cut(s) 227
RsaI GTAC 2 cut(s) 86, 106
RsaNI GTAC 2 cut(s) 85, 105
Sau96I GGNCC 1 cut(s) 227
SchI GAGTC 1 cut(s) 134
ScrFI CCNGG 2 cut(s) 174, 225
SduI GDGCHC 1 cut(s) 166
SetI ASST 3 cut(s) 104, 146, 229
SinI GGWCC 1 cut(s) 227
Sse9I AATT 1 cut(s) 17
SspMI CTAG 1 cut(s) 66
StyD4I CCNGG 2 cut(s) 172, 223
TaaI ACNGT 2 cut(s) 137, 161
TaqI TCGA 1 cut(s) 90
TasI AATT 1 cut(s) 17
TatI WGTACW 1 cut(s) 104
TscAI CASTG 1 cut(s) 77
TspRI CASTG 1 cut(s) 77
VpaK11BI GGWCC 1 cut(s) 227
XspI CTAG 1 cut(s) 66
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.