MD16G1261200.v1.1

This protein is one of the nuclear-coded polypeptide chains of cytochrome c oxidase, the terminal oxidase in mitochondrial electron transport

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr16
Physical Location & Seq
Forward (+)
32269528 .. 32272292
2765 bp
Loading structure...
UTR
Exon/CDS
Intron
MD16G1261200.v1.1.491

Sequence Viewer

Length: 234 bp
ATGGCCGAGATTGAGCTGAAAACAGCACCTGCTGATTTTCGATTCCCCACAACAAATCAAACTAGGCACTGTTTCTCGCGTTACATTGAATTTCATAGGTGCGTCTCAGCAAAGGGTGAAGAATCGAATGAATGTGAGAAATTTGCCAAATATTACCGCTCTCTCTGCCCTGGTGAATGGATTGAGAAGTGGGAAGAGCAGAGGGCGGGCGGAACTTTCCCAGGTCCTCTATAA

Protein Analysis

78

Amino Acids

9.01

Weight (kDa)

6.1

Isoelectric Point (pI)

61.91

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
COX6B PF02297 14 - 73 1.6e-22 Cytochrome oxidase c subunit VIb
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 37
Acc36I ACCTGC 1 cut(s) 37
AccBSI CCGCTC 1 cut(s) 159
AccII CGCG 1 cut(s) 79
AciI CCGC 3 cut(s) 157, 206, 210
AcoI YGGCCR 1 cut(s) 3
AcsI RAATTY 2 cut(s) 89, 140
AgsI TTSAA 1 cut(s) 89
AjnI CCWGG 2 cut(s) 169, 220
AluBI AGCT 1 cut(s) 16
AluI AGCT 1 cut(s) 16
Alw26I GTCTC 1 cut(s) 109
AlwNI CAGNNNCTG 1 cut(s) 29
AoxI GGCC 1 cut(s) 3
ApoI RAATTY 2 cut(s) 89, 140
AspS9I GGNCC 1 cut(s) 224
AsuHPI GGTGA 2 cut(s) 128, 185
AvaII GGWCC 1 cut(s) 224
BciT130I CCWGG 2 cut(s) 171, 222
BcoDI GTCTC 1 cut(s) 109
BfaI CTAG 1 cut(s) 63
BfuAI ACCTGC 1 cut(s) 37
Bme1390I CCNGG 2 cut(s) 171, 222
Bme18I GGWCC 1 cut(s) 224
BmgT120I GGNCC 1 cut(s) 224
BmrFI CCNGG 2 cut(s) 171, 222
BsaJI CCNNGG 2 cut(s) 169, 220
BseBI CCWGG 2 cut(s) 171, 222
BseDI CCNNGG 2 cut(s) 169, 220
BseMII CTCAG 1 cut(s) 120
Bsh1236I CGCG 1 cut(s) 79
BshFI GGCC 1 cut(s) 5
BsmAI GTCTC 1 cut(s) 109
BsmBI CGTCTC 1 cut(s) 109
BsnI GGCC 1 cut(s) 5
BspACI CCGC 3 cut(s) 157, 206, 210
BspANI GGCC 1 cut(s) 5
BspCNI CTCAG 1 cut(s) 119
BspFNI CGCG 1 cut(s) 79
BspMI ACCTGC 1 cut(s) 37
BspQI GCTCTTC 1 cut(s) 189
BsrBI CCGCTC 1 cut(s) 159
BssECI CCNNGG 2 cut(s) 169, 220
Bst2UI CCWGG 2 cut(s) 171, 222
Bst4CI ACNGT 1 cut(s) 71
Bst6I CTCTTC 1 cut(s) 189
BstC8I GCNNGC 1 cut(s) 208
BstDEI CTNAG 1 cut(s) 106
BstFNI CGCG 1 cut(s) 79
BstMAI GTCTC 1 cut(s) 109
BstMWI GCNNNNNNNGC 1 cut(s) 165
BstNI CCWGG 2 cut(s) 171, 222
BstSCI CCNGG 2 cut(s) 169, 220
BstUI CGCG 1 cut(s) 79
BsuRI GGCC 1 cut(s) 5
BtsIMutI CAGTG 1 cut(s) 67
BveI ACCTGC 1 cut(s) 37
Cac8I GCNNGC 1 cut(s) 208
CaiI CAGNNNCTG 1 cut(s) 29
Cfr13I GGNCC 1 cut(s) 224
CseI GACGC 1 cut(s) 91
CviJI RGCY 2 cut(s) 5, 16
CviKI_1 RGCY 2 cut(s) 5, 16
DdeI CTNAG 1 cut(s) 106
EaeI YGGCCR 1 cut(s) 3
Eam1104I CTCTTC 1 cut(s) 189
EarI CTCTTC 1 cut(s) 189
EciI GGCGGA 1 cut(s) 225
Eco47I GGWCC 1 cut(s) 224
EcoO109I RGGNCCY 1 cut(s) 224
EcoRII CCWGG 2 cut(s) 169, 220
Esp3I CGTCTC 1 cut(s) 109
FaiI YATR 2 cut(s) 96, 232
FauI CCCGC 1 cut(s) 199
FspBI CTAG 1 cut(s) 63
HaeIII GGCC 1 cut(s) 5
HgaI GACGC 1 cut(s) 91
HinfI GANTC 2 cut(s) 42, 122
HphI GGTGA 2 cut(s) 128, 185
HpyCH4III ACNGT 1 cut(s) 71
HpyF10VI GCNNNNNNNGC 1 cut(s) 165
HpyF3I CTNAG 1 cut(s) 106
LguI GCTCTTC 1 cut(s) 189
LpnPI CCDG 4 cut(s) 42, 156, 183, 207
MaeI CTAG 1 cut(s) 63
MaeIII GTNAC 1 cut(s) 80
MbiI CCGCTC 1 cut(s) 159
MboII GAAGA 2 cut(s) 131, 206
MluCI AATT 2 cut(s) 89, 140
MnlI CCTC 1 cut(s) 195
MspR9I CCNGG 2 cut(s) 171, 222
MvaI CCWGG 2 cut(s) 171, 222
MvnI CGCG 1 cut(s) 79
MwoI GCNNNNNNNGC 1 cut(s) 165
NmeAIII GCCGAG 1 cut(s) 31
PaqCI CACCTGC 1 cut(s) 37
PciSI GCTCTTC 1 cut(s) 189
PfeI GAWTC 2 cut(s) 42, 122
PpuMI RGGWCCY 1 cut(s) 224
Psp5II RGGWCCY 1 cut(s) 224
Psp6I CCWGG 2 cut(s) 169, 220
PspGI CCWGG 2 cut(s) 169, 220
PspPI GGNCC 1 cut(s) 224
PspPPI RGGWCCY 1 cut(s) 224
PstNI CAGNNNCTG 1 cut(s) 29
SapI GCTCTTC 1 cut(s) 189
Sau96I GGNCC 1 cut(s) 224
ScrFI CCNGG 2 cut(s) 171, 222
SetI ASST 4 cut(s) 18, 31, 101, 226
SgeI CNNG 8 cut(s) 19, 41, 75, 88, 90, 182, 183, 219
SinI GGWCC 1 cut(s) 224
Sse9I AATT 2 cut(s) 89, 140
SsiI CCGC 3 cut(s) 157, 206, 210
SspI AATATT 1 cut(s) 152
SspMI CTAG 1 cut(s) 63
StyD4I CCNGG 2 cut(s) 169, 220
TaaI ACNGT 1 cut(s) 71
TaqI TCGA 2 cut(s) 40, 125
TasI AATT 2 cut(s) 89, 140
TfiI GAWTC 2 cut(s) 42, 122
TscAI CASTG 1 cut(s) 74
TspDTI ATGAA 2 cut(s) 83, 144
TspRI CASTG 1 cut(s) 74
VpaK11BI GGWCC 1 cut(s) 224
XapI RAATTY 2 cut(s) 89, 140
XspI CTAG 1 cut(s) 63
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.