MD13G1274100.v1.1

This protein is one of the nuclear-coded polypeptide chains of cytochrome c oxidase, the terminal oxidase in mitochondrial electron transport

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr13
Physical Location & Seq
Reverse (-)
37196744 .. 37199696
2953 bp
Loading structure...
UTR
Exon/CDS
Intron
MD13G1274100.v1.1.491

Sequence Viewer

Length: 234 bp
ATGGCCGAGATTGAGCTGAAAACAGCACCTGCTGATTTTCGATTTCCCACAACAAATCAAACTAGGCACTGTTTCACGCGATACATTGAGTTTCATAGGTGCGTTGCAGCAAGGGGTGAAGAATCTAATGAGTGTGAGAAATTTGCCAAATATTACCGCTCCCTCTGCCCCGGTGAATGGATTGAGAAGTGGGAGGAGCAGAGGGCGGAAGGAACTTTCCCAGGTCCTCTATAA

Protein Analysis

78

Amino Acids

9.11

Weight (kDa)

5.67

Isoelectric Point (pI)

57.8

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
COX6B PF02297 14 - 74 1.8e-22 Cytochrome oxidase c subunit VIb
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 37
Acc36I ACCTGC 1 cut(s) 37
AccBSI CCGCTC 1 cut(s) 159
AccII CGCG 1 cut(s) 79
AciI CCGC 2 cut(s) 157, 206
AcoI YGGCCR 1 cut(s) 3
AcsI RAATTY 1 cut(s) 140
AfiI CCNNNNNNNGG 1 cut(s) 177
AjnI CCWGG 1 cut(s) 220
AluBI AGCT 1 cut(s) 16
AluI AGCT 1 cut(s) 16
AlwNI CAGNNNCTG 1 cut(s) 29
AoxI GGCC 1 cut(s) 3
ApeKI GCWGC 1 cut(s) 107
ApoI RAATTY 1 cut(s) 140
AspS9I GGNCC 1 cut(s) 224
AsuC2I CCSGG 1 cut(s) 171
AsuHPI GGTGA 2 cut(s) 128, 185
AvaII GGWCC 1 cut(s) 224
BbvI GCAGC 1 cut(s) 119
BciT130I CCWGG 1 cut(s) 222
BcnI CCSGG 1 cut(s) 171
BfaI CTAG 1 cut(s) 63
BfuAI ACCTGC 1 cut(s) 37
BisI GCNGC 1 cut(s) 108
BlsI GCNGC 1 cut(s) 109
Bme1390I CCNGG 2 cut(s) 171, 222
Bme18I GGWCC 1 cut(s) 224
BmgT120I GGNCC 1 cut(s) 224
BmrFI CCNGG 2 cut(s) 171, 222
BpuMI CCSGG 1 cut(s) 171
BsaJI CCNNGG 2 cut(s) 169, 220
Bsc4I CCNNNNNNNGG 1 cut(s) 177
BseBI CCWGG 1 cut(s) 222
BseDI CCNNGG 2 cut(s) 169, 220
BseLI CCNNNNNNNGG 1 cut(s) 177
BseRI GAGGAG 1 cut(s) 209
BseXI GCAGC 1 cut(s) 119
Bsh1236I CGCG 1 cut(s) 79
BshFI GGCC 1 cut(s) 5
BsiSI CCGG 1 cut(s) 171
BslI CCNNNNNNNGG 1 cut(s) 177
BsnI GGCC 1 cut(s) 5
BspACI CCGC 2 cut(s) 157, 206
BspANI GGCC 1 cut(s) 5
BspFNI CGCG 1 cut(s) 79
BspMI ACCTGC 1 cut(s) 37
BsrBI CCGCTC 1 cut(s) 159
BssECI CCNNGG 2 cut(s) 169, 220
Bst2UI CCWGG 1 cut(s) 222
Bst4CI ACNGT 1 cut(s) 71
BstFNI CGCG 1 cut(s) 79
BstMWI GCNNNNNNNGC 1 cut(s) 165
BstNI CCWGG 1 cut(s) 222
BstSCI CCNGG 2 cut(s) 169, 220
BstUI CGCG 1 cut(s) 79
BstV1I GCAGC 1 cut(s) 119
BsuRI GGCC 1 cut(s) 5
BtsIMutI CAGTG 1 cut(s) 67
BveI ACCTGC 1 cut(s) 37
CaiI CAGNNNCTG 1 cut(s) 29
Cfr13I GGNCC 1 cut(s) 224
CviJI RGCY 2 cut(s) 5, 16
CviKI_1 RGCY 2 cut(s) 5, 16
EaeI YGGCCR 1 cut(s) 3
EciI GGCGGA 1 cut(s) 221
Eco47I GGWCC 1 cut(s) 224
EcoO109I RGGNCCY 1 cut(s) 224
EcoRII CCWGG 1 cut(s) 220
FaiI YATR 2 cut(s) 96, 232
Fnu4HI GCNGC 1 cut(s) 108
Fsp4HI GCNGC 1 cut(s) 108
FspBI CTAG 1 cut(s) 63
GluI GCNGC 1 cut(s) 108
HaeIII GGCC 1 cut(s) 5
HapII CCGG 1 cut(s) 171
HinfI GANTC 1 cut(s) 122
HpaII CCGG 1 cut(s) 171
HphI GGTGA 2 cut(s) 128, 185
HpyAV CCTTC 1 cut(s) 203
HpyCH4III ACNGT 1 cut(s) 71
HpyCH4V TGCA 1 cut(s) 107
HpyF10VI GCNNNNNNNGC 1 cut(s) 165
LmnI GCTCC 2 cut(s) 164, 196
LpnPI CCDG 3 cut(s) 42, 184, 207
Lsp1109I GCAGC 1 cut(s) 119
MaeI CTAG 1 cut(s) 63
MbiI CCGCTC 1 cut(s) 159
MboII GAAGA 1 cut(s) 131
MluCI AATT 1 cut(s) 140
MnlI CCTC 3 cut(s) 173, 187, 195
MspI CCGG 1 cut(s) 171
MspR9I CCNGG 2 cut(s) 171, 222
MvaI CCWGG 1 cut(s) 222
MvnI CGCG 1 cut(s) 79
MwoI GCNNNNNNNGC 1 cut(s) 165
NciI CCSGG 1 cut(s) 171
NmeAIII GCCGAG 1 cut(s) 31
PaqCI CACCTGC 1 cut(s) 37
PfeI GAWTC 1 cut(s) 122
PkrI GCNGC 1 cut(s) 109
PpuMI RGGWCCY 1 cut(s) 224
Psp5II RGGWCCY 1 cut(s) 224
Psp6I CCWGG 1 cut(s) 220
PspGI CCWGG 1 cut(s) 220
PspPI GGNCC 1 cut(s) 224
PspPPI RGGWCCY 1 cut(s) 224
PstNI CAGNNNCTG 1 cut(s) 29
SatI GCNGC 1 cut(s) 108
Sau96I GGNCC 1 cut(s) 224
ScrFI CCNGG 2 cut(s) 171, 222
SetI ASST 4 cut(s) 18, 31, 101, 226
SgeI CNNG 8 cut(s) 19, 41, 75, 88, 90, 123, 182, 183
SinI GGWCC 1 cut(s) 224
Sse9I AATT 1 cut(s) 140
SsiI CCGC 2 cut(s) 157, 206
SspI AATATT 1 cut(s) 152
SspMI CTAG 1 cut(s) 63
StyD4I CCNGG 2 cut(s) 169, 220
TaaI ACNGT 1 cut(s) 71
TaqI TCGA 1 cut(s) 40
TasI AATT 1 cut(s) 140
TfiI GAWTC 1 cut(s) 122
TscAI CASTG 1 cut(s) 74
TseI GCWGC 1 cut(s) 107
TspDTI ATGAA 1 cut(s) 83
TspRI CASTG 1 cut(s) 74
VpaK11BI GGWCC 1 cut(s) 224
XapI RAATTY 1 cut(s) 140
XspI CTAG 1 cut(s) 63
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.