Basic Information

Type: gene

Biological Identity

Species

fragaria_vesca

Chromosome

Fvb3

Orthogroup ID

OG0001219

Physical Location & Seq

Genomic Coordinates Reverse (-)

14066664 .. 14067074

Gene Structure 411 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

FvH4_3g21050.t1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 327 bp

ATGACACTTGAGAAGGAAAAAGCTCCCCCATTATCCTCGAAACCAGCCAAATCTGGCAGAGGCAAGGAAAAGAAGAAGAAGTGGAGCAAGGGAAAACAAAAGGAGAAGGTGAACAACATGGTGCTGTTTGACCAGGCCACTTATGACAAGCTCCTCTCGGAAGGTCCTAAGTTCAAGCTCATCACTCCTTCTATCTTATCAAACAGGCTGAGGATTAATGGATCATTAGCACACCGTGTCATTAAGGATTTGATGGCAAAAGGTTCTATTAGGATGATTTCTGCCCATGCTAGTCAGCAGATTTACATCAGAGCCACCAACAGCTAA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

ko03010 map03010

Pfam Domains

Protein Families

Ribosomal_S25

Protein Analysis

109

Amino Acids

12.12

Weight (kDa)

10.46

Isoelectric Point (pI)

19.83

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
Ribosomal_S25	PF03297	10 - 104	1.3e-37	S25 ribosomal protein

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0001219)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT2G16360 AT2G21580 AT2G21580 AT4G34555 AT4G39200 AT4G39200
fragaria_vesca	FvH4_1g21830 FvH4_2g09230 FvH4_3g21050 FvH4_3g25090 FvH4_7g07520 FvH4_7g07520
malus_domestica	MD02G1289800.v1.1 MD03G1147300.v1.1 MD07G1037200.v1.1 MD11G1166000.v1.1
prunus_persica	Prupe.2G075600_v2.0.a1 Prupe.7G005700_v2.0.a1
pyrus_communis	pycom07g02600 pycom11g13780
rosa_chinensis	RchiOBHm_Chr1g0339301 RchiOBHm_Chr3g0463111 RchiOBHm_Chr5g0045631 RchiOBHm_Chr6g0265071
rosa_laevigata	RLG00000014211 RLG00000029224 RLG00000034365
rosa_multiflora	Rmu_sc0001248.1_g000014 Rmu_sc0028778.1_g000001 Rmu_ssc0000359.1_g000073 Rmu_ssc0000398.1_g000015
rosa_roxburghii	Rroxscaffold_1G00035590 Rroxscaffold_4G00313420 Rroxscaffold_7G00202980
rosa_rugosa	Rorug01G0142800.1 Rorug05G0223700 Rorug05G0223800 Rorug06G0013300
rosa_samantha	Rh1AG159800 Rh1BG126800 Rh1CG149000 Rh3AG119700 Rh3CG126100 Rh5AG304600 Rh5BG313300 Rh5CG339600 Rh5DG323800 Rh6AG136700 Rh6BG133500 Rh6CG131900 Rh6DG119200
rosa_wichuraiana	Rw0G020610 Rw0G021060 Rw1G013510 Rw5G028310 Rw6G011790

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AclWI	GGATC	1 cut(s)	229
AdeI	CACNNNGTG	1 cut(s)	236
AgsI	TTSAA	1 cut(s)	175
AjnI	CCWGG	1 cut(s)	132
AluBI	AGCT	4 cut(s)	23, 151, 178, 324
AluI	AGCT	4 cut(s)	23, 151, 178, 324
AlwI	GGATC	1 cut(s)	229
AoxI	GGCC	1 cut(s)	135
AseI	ATTAAT	1 cut(s)	216
AspS9I	GGNCC	1 cut(s)	164
AsuHPI	GGTGA	1 cut(s)	121
AvaII	GGWCC	1 cut(s)	164
BbvCI	CCTCAGC	1 cut(s)	209
BccI	CCATC	1 cut(s)	247
BciT130I	CCWGG	1 cut(s)	134
BfaI	CTAG	1 cut(s)	291
Bme1390I	CCNGG	1 cut(s)	134
Bme18I	GGWCC	1 cut(s)	164
BmgT120I	GGNCC	1 cut(s)	164
BmrFI	CCNGG	1 cut(s)	134
Bpu10I	CCTNAGC	1 cut(s)	209
BpuEI	CTTGAG	1 cut(s)	29
BsaBI	GATNNNNATC	1 cut(s)	305
Bse8I	GATNNNNATC	1 cut(s)	305
BseBI	CCWGG	1 cut(s)	134
BseGI	GGATG	1 cut(s)	279
BseJI	GATNNNNATC	1 cut(s)	305
BseMII	CTCAG	1 cut(s)	200
BseRI	GAGGAG	1 cut(s)	143
BshFI	GGCC	1 cut(s)	137
BsnI	GGCC	1 cut(s)	137
Bsp143I	GATC	1 cut(s)	221
BspANI	GGCC	1 cut(s)	137
BspCNI	CTCAG	1 cut(s)	201
BspPI	GGATC	1 cut(s)	229
BssMI	GATC	1 cut(s)	221
Bst2UI	CCWGG	1 cut(s)	134
Bst4CI	ACNGT	1 cut(s)	236
BstDEI	CTNAG	2 cut(s)	168, 209
BstF5I	GGATG	1 cut(s)	279
BstKTI	GATC	1 cut(s)	224
BstMBI	GATC	1 cut(s)	221
BstNI	CCWGG	1 cut(s)	134
BstSCI	CCNGG	1 cut(s)	132
BsuRI	GGCC	1 cut(s)	137
BtsCI	GGATG	1 cut(s)	279
Cfr13I	GGNCC	1 cut(s)	164
CviAII	CATG	2 cut(s)	118, 287
CviJI	RGCY	8 cut(s)	23, 47, 137, 151, 178, 208, 314, 324
CviKI_1	RGCY	8 cut(s)	23, 47, 137, 151, 178, 208, 314, 324
DdeI	CTNAG	2 cut(s)	168, 209
DpnI	GATC	1 cut(s)	223
DpnII	GATC	1 cut(s)	221
DraIII	CACNNNGTG	1 cut(s)	236
Eco47I	GGWCC	1 cut(s)	164
EcoO109I	RGGNCCY	1 cut(s)	164
EcoRII	CCWGG	1 cut(s)	132
FaeI	CATG	2 cut(s)	121, 290
FaiI	YATR	3 cut(s)	119, 144, 288
FatI	CATG	2 cut(s)	117, 286
FokI	GGATG	1 cut(s)	286
FspBI	CTAG	1 cut(s)	291
HaeIII	GGCC	1 cut(s)	137
Hin1II	CATG	2 cut(s)	121, 290
HphI	GGTGA	1 cut(s)	121
Hpy166II	GTNNAC	1 cut(s)	112
Hpy188I	TCNGA	2 cut(s)	160, 311
Hpy8I	GTNNAC	1 cut(s)	112
HpyAV	CCTTC	4 cut(s)	7, 100, 155, 198
HpyCH4III	ACNGT	1 cut(s)	236
HpyF3I	CTNAG	2 cut(s)	168, 209
Hsp92II	CATG	2 cut(s)	121, 290
Kzo9I	GATC	1 cut(s)	221
LmnI	GCTCC	3 cut(s)	28, 84, 156
LpnPI	CCDG	5 cut(s)	39, 57, 119, 146, 190
MaeI	CTAG	1 cut(s)	291
MalI	GATC	1 cut(s)	223
MboI	GATC	1 cut(s)	221
MboII	GAAGA	2 cut(s)	85, 88
MnlI	CCTC	4 cut(s)	46, 53, 164, 204
MseI	TTAA	2 cut(s)	216, 243
MspR9I	CCNGG	1 cut(s)	134
MvaI	CCWGG	1 cut(s)	134
NdeII	GATC	1 cut(s)	221
NlaIII	CATG	2 cut(s)	121, 290
PpuMI	RGGWCCY	1 cut(s)	164
PshBI	ATTAAT	1 cut(s)	216
Psp5II	RGGWCCY	1 cut(s)	164
Psp6I	CCWGG	1 cut(s)	132
PspGI	CCWGG	1 cut(s)	132
PspPI	GGNCC	1 cut(s)	164
PspPPI	RGGWCCY	1 cut(s)	164
SaqAI	TTAA	2 cut(s)	216, 243
Sau3AI	GATC	1 cut(s)	221
Sau96I	GGNCC	1 cut(s)	164
ScrFI	CCNGG	1 cut(s)	134
SetI	ASST	7 cut(s)	25, 111, 153, 166, 180, 265, 326
SinI	GGWCC	1 cut(s)	164
SmlI	CTYRAG	1 cut(s)	8
SmoI	CTYRAG	1 cut(s)	8
SspMI	CTAG	1 cut(s)	291
StyD4I	CCNGG	1 cut(s)	132
TaaI	ACNGT	1 cut(s)	236
TaqI	TCGA	1 cut(s)	38
Tru1I	TTAA	2 cut(s)	216, 243
Tru9I	TTAA	2 cut(s)	216, 243
VpaK11BI	GGWCC	1 cut(s)	164
VspI	ATTAAT	1 cut(s)	216
XspI	CTAG	1 cut(s)	291

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.