RLG00000034365

40S ribosomal protein

Basic Information

Type: gene
Biological Identity
rosa_laevigata
Chr7
Physical Location & Seq
Reverse (-)
41552614 .. 41554673
2060 bp
Loading structure...
UTR
Exon/CDS
Intron
RLM00000034365

Sequence Viewer

Length: 327 bp
ATGGCACCCAAGAAGGAAAAGGCTCCCCCACCGTCCTCAAAGCCCGCCAAATCTGGCGGAGGCAAGCAGAAGAAGAAGAAGTGGAGCAAGGGTAAGCAAAAGGAGAAGGTGAACAACATGGTGTTGTTTGATCAGGCCACTTATGACAAGCTTCTCTCGGAGGCTCCCAAGTTCAAGCTCATCACTCCTTCTATCTTGTCCGACAGGCTGAGGATTAATGGATCATTGGCACGCCGTGCAATTAAGGATTTGATGGCAAGGGGTTCTATTAGGATGATTTCTGCTCATGCTAGTCAGCAGATCTACACCAGAGCCACCAATACCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

109

Amino Acids

11.99

Weight (kDa)

10.7

Isoelectric Point (pI)

37.46

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Ribosomal_S25 PF03297 7 - 105 7.3e-41 S25 ribosomal protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 4
AciI CCGC 2 cut(s) 45, 57
AclWI GGATC 1 cut(s) 229
AdeI CACNNNGTG 1 cut(s) 236
AgsI TTSAA 1 cut(s) 175
AluBI AGCT 2 cut(s) 151, 178
AluI AGCT 2 cut(s) 151, 178
AlwI GGATC 1 cut(s) 229
AoxI GGCC 1 cut(s) 135
AseI ATTAAT 1 cut(s) 216
AsuHPI GGTGA 1 cut(s) 121
BanI GGYRCC 1 cut(s) 4
BbvCI CCTCAGC 1 cut(s) 209
BccI CCATC 1 cut(s) 247
BceAI ACGGC 1 cut(s) 219
BclI TGATCA 1 cut(s) 130
BfaI CTAG 1 cut(s) 291
BglII AGATCT 1 cut(s) 300
BmiI GGNNCC 3 cut(s) 6, 24, 165
Bpu10I CCTNAGC 1 cut(s) 209
BsaXI ACNNNNNCTCC 2 cut(s) 76, 106
BseGI GGATG 1 cut(s) 279
BseMII CTCAG 1 cut(s) 200
BshFI GGCC 1 cut(s) 137
BshNI GGYRCC 1 cut(s) 4
BsnI GGCC 1 cut(s) 137
Bsp143I GATC 3 cut(s) 130, 221, 300
BspACI CCGC 2 cut(s) 45, 57
BspANI GGCC 1 cut(s) 137
BspCNI CTCAG 1 cut(s) 201
BspLI GGNNCC 3 cut(s) 6, 24, 165
BspPI GGATC 1 cut(s) 229
BspT107I GGYRCC 1 cut(s) 4
BssMI GATC 3 cut(s) 130, 221, 300
Bst4CI ACNGT 1 cut(s) 33
BstAPI GCANNNNNTGC 1 cut(s) 236
BstC8I GCNNGC 3 cut(s) 45, 65, 232
BstDEI CTNAG 1 cut(s) 209
BstF5I GGATG 1 cut(s) 279
BstKTI GATC 3 cut(s) 133, 224, 303
BstMBI GATC 3 cut(s) 130, 221, 300
BstMWI GCNNNNNNNGC 1 cut(s) 236
BstX2I RGATCY 1 cut(s) 300
BstYI RGATCY 1 cut(s) 300
BsuRI GGCC 1 cut(s) 137
BtsCI GGATG 1 cut(s) 279
Cac8I GCNNGC 3 cut(s) 45, 65, 232
CviAII CATG 2 cut(s) 118, 287
CviJI RGCY 8 cut(s) 23, 43, 137, 151, 164, 178, 208, 314
CviKI_1 RGCY 8 cut(s) 23, 43, 137, 151, 164, 178, 208, 314
DdeI CTNAG 1 cut(s) 209
DpnI GATC 3 cut(s) 132, 223, 302
DpnII GATC 3 cut(s) 130, 221, 300
DraIII CACNNNGTG 1 cut(s) 236
EciI GGCGGA 1 cut(s) 72
FaeI CATG 2 cut(s) 121, 290
FaiI YATR 3 cut(s) 119, 144, 288
FatI CATG 2 cut(s) 117, 286
FauI CCCGC 1 cut(s) 52
FbaI TGATCA 1 cut(s) 130
FokI GGATG 1 cut(s) 286
FspBI CTAG 1 cut(s) 291
HaeIII GGCC 1 cut(s) 137
Hin1II CATG 2 cut(s) 121, 290
HindIII AAGCTT 1 cut(s) 149
HphI GGTGA 1 cut(s) 121
Hpy166II GTNNAC 1 cut(s) 112
Hpy188I TCNGA 2 cut(s) 160, 202
Hpy8I GTNNAC 1 cut(s) 112
HpyAV CCTTC 3 cut(s) 7, 100, 198
HpyCH4III ACNGT 1 cut(s) 33
HpyCH4V TGCA 1 cut(s) 239
HpyF10VI GCNNNNNNNGC 1 cut(s) 236
HpyF3I CTNAG 1 cut(s) 209
Hsp92II CATG 2 cut(s) 121, 290
Ksp22I TGATCA 1 cut(s) 130
Kzo9I GATC 3 cut(s) 130, 221, 300
LmnI GCTCC 3 cut(s) 28, 84, 169
LpnPI CCDG 4 cut(s) 39, 119, 190, 322
MaeI CTAG 1 cut(s) 291
MalI GATC 3 cut(s) 132, 223, 302
MboI GATC 3 cut(s) 130, 221, 300
MboII GAAGA 3 cut(s) 82, 85, 88
MflI RGATCY 1 cut(s) 300
MluCI AATT 1 cut(s) 240
MmeI TCCRAC 1 cut(s) 225
MnlI CCTC 4 cut(s) 46, 53, 154, 204
MseI TTAA 2 cut(s) 216, 243
MwoI GCNNNNNNNGC 1 cut(s) 236
NdeII GATC 3 cut(s) 130, 221, 300
NlaIII CATG 2 cut(s) 121, 290
NlaIV GGNNCC 3 cut(s) 6, 24, 165
PshBI ATTAAT 1 cut(s) 216
PspN4I GGNNCC 3 cut(s) 6, 24, 165
PsuI RGATCY 1 cut(s) 300
SaqAI TTAA 2 cut(s) 216, 243
Sau3AI GATC 3 cut(s) 130, 221, 300
SetI ASST 4 cut(s) 111, 153, 180, 326
Sse9I AATT 1 cut(s) 240
SsiI CCGC 2 cut(s) 45, 57
SspMI CTAG 1 cut(s) 291
TaaI ACNGT 1 cut(s) 33
TasI AATT 1 cut(s) 240
Tru1I TTAA 2 cut(s) 216, 243
Tru9I TTAA 2 cut(s) 216, 243
VspI ATTAAT 1 cut(s) 216
XspI CTAG 1 cut(s) 291
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.