FvH4_4g01570

Belongs to the eukaryotic ribosomal protein P1 P2 family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb4
OG0003295
Physical Location & Seq
Reverse (-)
1395208 .. 1395540
333 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_4g01570.t1

Sequence Viewer

Length: 333 bp
ATGAAGGTGCTTGCTGCTTACATGCTCGCTCGATTGGGAGGGAACACCAATCCTTCTGCCGATGATCTGAAAAGAATTTTAGGAGCAGTTGGAGCTGAGATTGATGGACACAGAATTGAGTTGTTCTTGTCCAAAGTCAATGGAAAAAATATCGACGAGCTAGTTGCATCTGGAAAAGAGAAGTTGGCATCTGTGCCTTCCGTTGGTGACACTAGTGCTGCAGCTCCTCCTGCTGTTGTTCAGGAGACTAAGGAAGAGAAGGATGAAGAAGAAGAAGAAGAAGAAGAGGACGATGGACCTGATATTTTCGATCTATTTGGCCCTGACAACTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko03010 map03010
Pfam Domains
Protein Families
Ribosomal_60s

Protein Analysis

111

Amino Acids

11.74

Weight (kDa)

4.22

Isoelectric Point (pI)

52.55

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Ribosomal_60s PF00428 17 - 106 1.1e-18 60s Acidic ribosomal protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 75
AfiI CCNNNNNNNGG 1 cut(s) 203
AhlI ACTAGT 1 cut(s) 212
AluBI AGCT 3 cut(s) 95, 160, 224
AluI AGCT 3 cut(s) 95, 160, 224
Alw26I GTCTC 1 cut(s) 239
AoxI GGCC 1 cut(s) 319
ApeKI GCWGC 3 cut(s) 14, 218, 221
ApoI RAATTY 1 cut(s) 75
AspS9I GGNCC 2 cut(s) 296, 320
AsuHPI GGTGA 1 cut(s) 218
AvaII GGWCC 1 cut(s) 296
BbvI GCAGC 2 cut(s) 205, 233
BccI CCATC 2 cut(s) 98, 287
BcgI CGANNNNNNTGC 2 cut(s) 146, 180
BcoDI GTCTC 1 cut(s) 239
BcuI ACTAGT 1 cut(s) 212
BfaI CTAG 2 cut(s) 161, 213
BfmI CTRYAG 1 cut(s) 219
BisI GCNGC 3 cut(s) 15, 219, 222
BlsI GCNGC 3 cut(s) 16, 220, 223
Bme18I GGWCC 1 cut(s) 296
BmgT120I GGNCC 2 cut(s) 296, 320
BmsI GCATC 2 cut(s) 176, 197
Bsc4I CCNNNNNNNGG 1 cut(s) 203
BseGI GGATG 1 cut(s) 268
BseLI CCNNNNNNNGG 1 cut(s) 203
BseMII CTCAG 1 cut(s) 87
BseRI GAGGAG 1 cut(s) 216
BseXI GCAGC 2 cut(s) 205, 233
BshFI GGCC 1 cut(s) 321
BslI CCNNNNNNNGG 1 cut(s) 203
BsmAI GTCTC 1 cut(s) 239
BsnI GGCC 1 cut(s) 321
Bsp143I GATC 2 cut(s) 64, 310
BspANI GGCC 1 cut(s) 321
BspCNI CTCAG 1 cut(s) 88
BspMAI CTGCAG 1 cut(s) 223
BssMI GATC 2 cut(s) 64, 310
Bst6I CTCTTC 2 cut(s) 249, 279
BstC8I GCNNGC 2 cut(s) 12, 27
BstDEI CTNAG 2 cut(s) 96, 249
BstF5I GGATG 1 cut(s) 268
BstKTI GATC 2 cut(s) 67, 313
BstMAI GTCTC 1 cut(s) 239
BstMBI GATC 2 cut(s) 64, 310
BstMWI GCNNNNNNNGC 2 cut(s) 92, 230
BstNSI RCATGY 1 cut(s) 25
BstSFI CTRYAG 1 cut(s) 219
BstV1I GCAGC 2 cut(s) 205, 233
BsuRI GGCC 1 cut(s) 321
BtsCI GGATG 1 cut(s) 268
Cac8I GCNNGC 2 cut(s) 12, 27
Cfr13I GGNCC 2 cut(s) 296, 320
CviAII CATG 1 cut(s) 22
CviJI RGCY 4 cut(s) 95, 160, 224, 321
CviKI_1 RGCY 4 cut(s) 95, 160, 224, 321
DdeI CTNAG 2 cut(s) 96, 249
DpnI GATC 2 cut(s) 66, 312
DpnII GATC 2 cut(s) 64, 310
Eam1104I CTCTTC 2 cut(s) 249, 279
EarI CTCTTC 2 cut(s) 249, 279
Eco47I GGWCC 1 cut(s) 296
FaeI CATG 1 cut(s) 25
FaiI YATR 1 cut(s) 23
FatI CATG 1 cut(s) 21
Fnu4HI GCNGC 3 cut(s) 15, 219, 222
FokI GGATG 1 cut(s) 275
Fsp4HI GCNGC 3 cut(s) 15, 219, 222
FspBI CTAG 2 cut(s) 161, 213
GluI GCNGC 3 cut(s) 15, 219, 222
HaeIII GGCC 1 cut(s) 321
Hin1II CATG 1 cut(s) 25
HphI GGTGA 1 cut(s) 218
Hpy188I TCNGA 1 cut(s) 69
Hpy188III TCNNGA 2 cut(s) 171, 242
Hpy99I CGWCG 1 cut(s) 158
HpyAV CCTTC 3 cut(s) 63, 207, 253
HpyCH4V TGCA 2 cut(s) 167, 221
HpyF10VI GCNNNNNNNGC 2 cut(s) 92, 230
HpyF3I CTNAG 2 cut(s) 96, 249
Hsp92II CATG 1 cut(s) 25
Kzo9I GATC 2 cut(s) 64, 310
LmnI GCTCC 3 cut(s) 83, 92, 229
LpnPI CCDG 4 cut(s) 156, 227, 243, 312
Lsp1109I GCAGC 2 cut(s) 205, 233
LweI GCATC 2 cut(s) 176, 197
MaeI CTAG 2 cut(s) 161, 213
MaeIII GTNAC 1 cut(s) 206
MalI GATC 2 cut(s) 66, 312
MboI GATC 2 cut(s) 64, 310
MboII GAAGA 8 cut(s) 266, 278, 281, 284, 287, 290, 293, 296
MluCI AATT 2 cut(s) 75, 114
MmeI TCCRAC 1 cut(s) 70
MnlI CCTC 3 cut(s) 32, 237, 280
MwoI GCNNNNNNNGC 2 cut(s) 92, 230
NdeII GATC 2 cut(s) 64, 310
NlaIII CATG 1 cut(s) 25
NmuCI GTSAC 1 cut(s) 206
NspI RCATGY 1 cut(s) 25
PkrI GCNGC 3 cut(s) 16, 220, 223
PspPI GGNCC 2 cut(s) 296, 320
PstI CTGCAG 1 cut(s) 223
SatI GCNGC 3 cut(s) 15, 219, 222
Sau3AI GATC 2 cut(s) 64, 310
Sau96I GGNCC 2 cut(s) 296, 320
SetI ASST 5 cut(s) 9, 97, 162, 226, 301
SfaNI GCATC 2 cut(s) 176, 197
SfcI CTRYAG 1 cut(s) 219
SinI GGWCC 1 cut(s) 296
SpeI ACTAGT 1 cut(s) 212
Sse9I AATT 2 cut(s) 75, 114
SspMI CTAG 2 cut(s) 161, 213
TaqI TCGA 3 cut(s) 31, 153, 309
TasI AATT 2 cut(s) 75, 114
TseFI GTSAC 1 cut(s) 206
TseI GCWGC 3 cut(s) 14, 218, 221
Tsp45I GTSAC 1 cut(s) 206
TspDTI ATGAA 2 cut(s) 17, 279
TspGWI ACGGA 1 cut(s) 190
VpaK11BI GGWCC 1 cut(s) 296
XapI RAATTY 1 cut(s) 75
XceI RCATGY 1 cut(s) 25
XspI CTAG 2 cut(s) 161, 213
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.