Rroxscaffold_1G00037440

Belongs to the eukaryotic ribosomal protein P1 P2 family

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000001
Physical Location & Seq
Forward (+)
54620303 .. 54621594
1292 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_1G00037440.1

Sequence Viewer

Length: 159 bp
ATGAAGGTTGTTGCTGCATATCTTCTGGCTGTTTTGGGAGGGAACACCAGCCCCTCAGCTGATGATGTGAAGAATATTCTTAGCTCAGTTGGAGCTGAGGCTGATGGTGATAGGATTGAGTTGCTAATTATCCCAAGTGAAAGTCAAAGATATCACTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

52

Amino Acids

5.49

Weight (kDa)

4.65

Isoelectric Point (pI)

50.39

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AluBI AGCT 3 cut(s) 59, 84, 95
AluI AGCT 3 cut(s) 59, 84, 95
ApeKI GCWGC 1 cut(s) 14
AsuHPI GGTGA 1 cut(s) 119
BbvCI CCTCAGC 2 cut(s) 55, 96
BccI CCATC 1 cut(s) 98
BisI GCNGC 1 cut(s) 15
BlsI GCNGC 1 cut(s) 16
Bpu10I CCTNAGC 2 cut(s) 55, 96
BseMII CTCAG 3 cut(s) 69, 87, 99
BspCNI CTCAG 3 cut(s) 68, 88, 98
BstDEI CTNAG 4 cut(s) 55, 80, 85, 96
BtsIMutI CAGTG 1 cut(s) 154
CviJI RGCY 6 cut(s) 29, 51, 59, 84, 95, 101
CviKI_1 RGCY 6 cut(s) 29, 51, 59, 84, 95, 101
DdeI CTNAG 4 cut(s) 55, 80, 85, 96
Eco32I GATATC 1 cut(s) 152
EcoRV GATATC 1 cut(s) 152
FaiI YATR 1 cut(s) 19
Fnu4HI GCNGC 1 cut(s) 15
Fsp4HI GCNGC 1 cut(s) 15
GluI GCNGC 1 cut(s) 15
HphI GGTGA 1 cut(s) 119
HpyCH4V TGCA 1 cut(s) 17
HpyF3I CTNAG 4 cut(s) 55, 80, 85, 96
LmnI GCTCC 1 cut(s) 92
LpnPI CCDG 2 cut(s) 11, 61
MboII GAAGA 2 cut(s) 14, 82
MluCI AATT 1 cut(s) 126
MmeI TCCRAC 1 cut(s) 70
MnlI CCTC 3 cut(s) 32, 64, 91
MspA1I CMGCKG 1 cut(s) 59
PkrI GCNGC 1 cut(s) 16
PvuII CAGCTG 1 cut(s) 59
SatI GCNGC 1 cut(s) 15
SetI ASST 4 cut(s) 9, 61, 86, 97
SgeI CNNG 3 cut(s) 38, 60, 147
Sse9I AATT 1 cut(s) 126
SspI AATATT 1 cut(s) 76
TasI AATT 1 cut(s) 126
TseI GCWGC 1 cut(s) 14
TspDTI ATGAA 1 cut(s) 17
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.