FvH4_5g32992

Belongs to the ATPase B chain family

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb5
Physical Location & Seq
Forward (+)
23823591 .. 23823934
344 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_5g32992.t1

Sequence Viewer

Length: 264 bp
ATGCTCCTCCCTCTCCAAATTTCCATTCCTAAAACCCTCACCAAACCCCACCTCCTCCTATCCCTCAAATCCCTCTCCGACATCGCCGCCACCTCTCTTGCCTTGGAGCTGTCGTCCCTCACCACATATATCAAGAAGGCGGCTCTCTTCAACTTCTACCTTACCCTCCTGATTCAGGCTGTTGATCAATTAGAAGTTAGGAAGCGTGAAGGACACATCGACGACACATCGGCGGAGGTGAAGCAGCTGGAGGAGCAGGGGTGA

Protein Analysis

88

Amino Acids

9.68

Weight (kDa)

6.05

Isoelectric Point (pI)

30.62

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 3 cut(s) 87, 140, 233
AcsI RAATTY 1 cut(s) 18
AfiI CCNNNNNNNGG 1 cut(s) 175
AgsI TTSAA 1 cut(s) 151
AjuI GAANNNNNNNTTGG 2 cut(s) 9, 41
AluBI AGCT 2 cut(s) 109, 247
AluI AGCT 2 cut(s) 109, 247
ApeKI GCWGC 1 cut(s) 244
ApoI RAATTY 1 cut(s) 18
AsuHPI GGTGA 3 cut(s) 31, 112, 250
BbvI GCAGC 1 cut(s) 256
BclI TGATCA 1 cut(s) 184
BisI GCNGC 3 cut(s) 87, 141, 245
BlsI GCNGC 3 cut(s) 88, 142, 246
BsaJI CCNNGG 1 cut(s) 102
BsaXI ACNNNNNCTCC 5 cut(s) 36, 66, 98, 128, 245
Bsc4I CCNNNNNNNGG 1 cut(s) 175
BseDI CCNNGG 1 cut(s) 102
BseLI CCNNNNNNNGG 1 cut(s) 175
BseRI GAGGAG 1 cut(s) 44
BseXI GCAGC 1 cut(s) 256
BslFI GGGAC 1 cut(s) 100
BslI CCNNNNNNNGG 1 cut(s) 175
BsmFI GGGAC 1 cut(s) 100
Bsp143I GATC 1 cut(s) 184
BspACI CCGC 3 cut(s) 87, 140, 233
BssECI CCNNGG 1 cut(s) 102
BssMI GATC 1 cut(s) 184
BssT1I CCWWGG 1 cut(s) 102
Bst6I CTCTTC 1 cut(s) 152
BstENI CCTNNNNNAGG 1 cut(s) 173
BstKTI GATC 1 cut(s) 187
BstMBI GATC 1 cut(s) 184
BstMWI GCNNNNNNNGC 1 cut(s) 253
BstV1I GCAGC 1 cut(s) 256
BtgZI GCGATG 1 cut(s) 67
CspCI CAANNNNNGTGG 2 cut(s) 79, 114
CviJI RGCY 4 cut(s) 109, 143, 179, 247
CviKI_1 RGCY 4 cut(s) 109, 143, 179, 247
DpnI GATC 1 cut(s) 186
DpnII GATC 1 cut(s) 184
Eam1104I CTCTTC 1 cut(s) 152
EarI CTCTTC 1 cut(s) 152
EciI GGCGGA 1 cut(s) 248
Eco130I CCWWGG 1 cut(s) 102
EcoNI CCTNNNNNAGG 1 cut(s) 173
EcoT14I CCWWGG 1 cut(s) 102
ErhI CCWWGG 1 cut(s) 102
FaiI YATR 2 cut(s) 127, 129
FaqI GGGAC 1 cut(s) 100
FbaI TGATCA 1 cut(s) 184
Fnu4HI GCNGC 3 cut(s) 87, 141, 245
Fsp4HI GCNGC 3 cut(s) 87, 141, 245
GluI GCNGC 3 cut(s) 87, 141, 245
HinfI GANTC 1 cut(s) 172
HphI GGTGA 3 cut(s) 31, 112, 250
Hpy188I TCNGA 1 cut(s) 79
Hpy188III TCNNGA 2 cut(s) 133, 169
Hpy99I CGWCG 1 cut(s) 224
HpyAV CCTTC 2 cut(s) 130, 203
HpyF10VI GCNNNNNNNGC 1 cut(s) 253
Ksp22I TGATCA 1 cut(s) 184
Kzo9I GATC 1 cut(s) 184
LmnI GCTCC 3 cut(s) 9, 106, 253
LpnPI CCDG 4 cut(s) 161, 182, 233, 242
Lsp1109I GCAGC 1 cut(s) 256
MalI GATC 1 cut(s) 186
MboI GATC 1 cut(s) 184
MboII GAAGA 1 cut(s) 139
MluCI AATT 2 cut(s) 18, 188
MmeI TCCRAC 1 cut(s) 102
MspA1I CMGCKG 1 cut(s) 247
MwoI GCNNNNNNNGC 1 cut(s) 253
NdeII GATC 1 cut(s) 184
PfeI GAWTC 1 cut(s) 172
PkrI GCNGC 3 cut(s) 88, 142, 246
PvuII CAGCTG 1 cut(s) 247
SatI GCNGC 3 cut(s) 87, 141, 245
Sau3AI GATC 1 cut(s) 184
SetI ASST 6 cut(s) 54, 95, 111, 162, 240, 249
SgeI CNNG 7 cut(s) 110, 115, 145, 181, 188, 218, 260
Sse9I AATT 2 cut(s) 18, 188
SsiI CCGC 3 cut(s) 87, 140, 233
StyI CCWWGG 1 cut(s) 102
TaqI TCGA 1 cut(s) 219
TasI AATT 2 cut(s) 18, 188
TauI GCSGC 2 cut(s) 89, 143
TfiI GAWTC 1 cut(s) 172
TseI GCWGC 1 cut(s) 244
XagI CCTNNNNNAGG 1 cut(s) 173
XapI RAATTY 1 cut(s) 18
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.