FvH4_7g12970

Basic blue protein-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb7
OG0007529
Physical Location & Seq
Reverse (-)
11714296 .. 11714743
448 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_7g12970.t1

Sequence Viewer

Length: 351 bp
ATGGCACGATACTCGGCTCTTTCTCTGCTTGCGTTTCTGGTTTCTCCGATCATGGTGATGGCAACATCATACGAAGTTGACTGGTCAGTTGGAGTTGATTTCACTGCTTTTGCTACTCAAAACCATTTCTATGCTGGAGATGTGTTGAATTTTCATTATGATAGAGTTCATAACAATGTAGTTATAGCAACCAATGGTGATGAGTTTGATCAATGCGAGATGGAACCAAACTTGGGTTATTATCAAAGTGGCAATGAAGCATTTACCTTGCCTGAAGCTGGATACTATTATTTCATGTGCGGGTATCACTGCAAATCTGATGGCATGAGAATGACAGTGTTTGTAAACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Cu_bind_like

Protein Analysis

117

Amino Acids

13.19

Weight (kDa)

4.45

Isoelectric Point (pI)

26.65

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Cu_bind_like PF02298 28 - 106 3.3e-14 Plastocyanin-like domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 300
AcsI RAATTY 1 cut(s) 148
AcuI CTGAAG 1 cut(s) 294
AfiI CCNNNNNNNGG 2 cut(s) 233, 278
AgsI TTSAA 1 cut(s) 148
AluBI AGCT 1 cut(s) 278
AluI AGCT 1 cut(s) 278
ApoI RAATTY 1 cut(s) 148
AsuHPI GGTGA 2 cut(s) 67, 209
BccI CCATC 3 cut(s) 52, 214, 314
BcgI CGANNNNNNTGC 1 cut(s) 28
BciVI GTATCC 1 cut(s) 275
BclI TGATCA 1 cut(s) 208
BfaI CTAG 1 cut(s) 349
BfuI GTATCC 1 cut(s) 275
BmiI GGNNCC 1 cut(s) 225
BpmI CTGGAG 1 cut(s) 156
Bsc4I CCNNNNNNNGG 2 cut(s) 233, 278
Bse1I ACTGG 1 cut(s) 86
Bse3DI GCAATG 1 cut(s) 259
BseLI CCNNNNNNNGG 2 cut(s) 233, 278
BseMI GCAATG 1 cut(s) 259
BseNI ACTGG 1 cut(s) 86
BslI CCNNNNNNNGG 2 cut(s) 233, 278
Bsp143I GATC 2 cut(s) 48, 208
BspACI CCGC 1 cut(s) 300
BspLI GGNNCC 1 cut(s) 225
BsrDI GCAATG 1 cut(s) 259
BsrI ACTGG 1 cut(s) 86
BssMI GATC 2 cut(s) 48, 208
Bst4CI ACNGT 1 cut(s) 337
BstC8I GCNNGC 1 cut(s) 30
BstKTI GATC 2 cut(s) 51, 211
BstMBI GATC 2 cut(s) 48, 208
BsuI GTATCC 1 cut(s) 275
BtsI GCAGTG 2 cut(s) 102, 307
BtsIMutI CAGTG 3 cut(s) 102, 307, 342
Cac8I GCNNGC 1 cut(s) 30
CviAII CATG 3 cut(s) 52, 295, 325
CviJI RGCY 2 cut(s) 17, 278
CviKI_1 RGCY 2 cut(s) 17, 278
DpnI GATC 2 cut(s) 50, 210
DpnII GATC 2 cut(s) 48, 208
Eco57I CTGAAG 1 cut(s) 294
FaeI CATG 3 cut(s) 55, 298, 328
FaiI YATR 8 cut(s) 53, 70, 132, 159, 171, 185, 296, 326
FatI CATG 3 cut(s) 51, 294, 324
FauI CCCGC 1 cut(s) 293
FbaI TGATCA 1 cut(s) 208
FspBI CTAG 1 cut(s) 349
GsuI CTGGAG 1 cut(s) 156
Hin1II CATG 3 cut(s) 55, 298, 328
HincII GTYRAC 1 cut(s) 79
HindII GTYRAC 1 cut(s) 79
HphI GGTGA 2 cut(s) 67, 209
Hpy166II GTNNAC 2 cut(s) 79, 346
Hpy188I TCNGA 2 cut(s) 48, 319
Hpy8I GTNNAC 2 cut(s) 79, 346
HpyCH4III ACNGT 1 cut(s) 337
HpyCH4V TGCA 1 cut(s) 312
Hsp92II CATG 3 cut(s) 55, 298, 328
Ksp22I TGATCA 1 cut(s) 208
Kzo9I GATC 2 cut(s) 48, 208
LpnPI CCDG 5 cut(s) 23, 67, 120, 264, 285
MaeI CTAG 1 cut(s) 349
MalI GATC 2 cut(s) 50, 210
MboI GATC 2 cut(s) 48, 208
MluCI AATT 1 cut(s) 148
MmeI TCCRAC 1 cut(s) 70
MslI CAYNNNNRTG 4 cut(s) 56, 129, 174, 329
NdeII GATC 2 cut(s) 48, 208
NlaIII CATG 3 cut(s) 55, 298, 328
NlaIV GGNNCC 1 cut(s) 225
PspN4I GGNNCC 1 cut(s) 225
RseI CAYNNNNRTG 4 cut(s) 56, 129, 174, 329
Sau3AI GATC 2 cut(s) 48, 208
SetI ASST 2 cut(s) 269, 280
SmiMI CAYNNNNRTG 4 cut(s) 56, 129, 174, 329
Sse9I AATT 1 cut(s) 148
SsiI CCGC 1 cut(s) 300
SspMI CTAG 1 cut(s) 349
TaaI ACNGT 1 cut(s) 337
TasI AATT 1 cut(s) 148
TscAI CASTG 3 cut(s) 109, 314, 342
TspDTI ATGAA 4 cut(s) 143, 158, 270, 283
TspRI CASTG 3 cut(s) 109, 314, 342
XapI RAATTY 1 cut(s) 148
XcmI CCANNNNNNNNNTGG 1 cut(s) 131
XspI CTAG 1 cut(s) 349
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.