Rroxscaffold_4G00303200

Basic blue protein-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000004
OG0007529
Physical Location & Seq
Forward (+)
23592291 .. 23593857
1567 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_4G00303200.1

Sequence Viewer

Length: 366 bp
ATGGCAGTGGCACGATACTTGGCTCTTGCTCTGATTGCGTTTCTCGTTTCTCCGATCATGGTGATGGCAACAACATACGACATTAAATGGGCAGCAGGAATTGATTACACTGGTTTTGTTGCTCAGAACACTTTCTATGCTGGAGATGTGCATCATGTGATAAATTTTCATTGGGATATCGCTTATCACAATCTGATTATAGCAACAGATGGTGATGCATTTGATCAGTGCAAGAATAAACTGAACTTGGGTCACTATACAAGTGGAAATGAAGCATTAACCTTGGGTGAAGTTGGATACTATTATTTCATGTGTGGGTTTGACTGCAAATCTGATGGCATGAAAATGTCGGTGTTTGTGAACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Cu_bind_like

Protein Analysis

121

Amino Acids

13.5

Weight (kDa)

5.26

Isoelectric Point (pI)

30.58

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Cu_bind_like PF02298 30 - 108 1.4e-09 Plastocyanin-like domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 163
ApeKI GCWGC 1 cut(s) 92
ApoI RAATTY 1 cut(s) 163
Asp700I GAANNNNTTC 1 cut(s) 131
AsuHPI GGTGA 3 cut(s) 73, 224, 299
BbvI GCAGC 1 cut(s) 104
BccI CCATC 3 cut(s) 58, 203, 329
BciVI GTATCC 1 cut(s) 290
BclI TGATCA 1 cut(s) 223
BfaI CTAG 1 cut(s) 364
BfuI GTATCC 1 cut(s) 290
BisI GCNGC 1 cut(s) 93
BlsI GCNGC 1 cut(s) 94
BmsI GCATC 2 cut(s) 160, 205
BpmI CTGGAG 1 cut(s) 162
BsaBI GATNNNNATC 1 cut(s) 150
BsaJI CCNNGG 1 cut(s) 282
Bse1I ACTGG 1 cut(s) 115
Bse8I GATNNNNATC 1 cut(s) 150
BseDI CCNNGG 1 cut(s) 282
BseJI GATNNNNATC 1 cut(s) 150
BseMII CTCAG 1 cut(s) 137
BseNI ACTGG 1 cut(s) 115
BseXI GCAGC 1 cut(s) 104
Bsp143I GATC 2 cut(s) 54, 223
BspCNI CTCAG 1 cut(s) 136
BsrI ACTGG 1 cut(s) 115
BssECI CCNNGG 1 cut(s) 282
BssMI GATC 2 cut(s) 54, 223
BssT1I CCWWGG 1 cut(s) 282
BstDEI CTNAG 1 cut(s) 123
BstKTI GATC 2 cut(s) 57, 226
BstMBI GATC 2 cut(s) 54, 223
BstMWI GCNNNNNNNGC 1 cut(s) 35
BstV1I GCAGC 1 cut(s) 104
BsuI GTATCC 1 cut(s) 290
BtsI GCAGTG 1 cut(s) 12
BtsIMutI CAGTG 3 cut(s) 12, 108, 233
CviAII CATG 4 cut(s) 58, 155, 310, 340
CviJI RGCY 1 cut(s) 23
CviKI_1 RGCY 1 cut(s) 23
DdeI CTNAG 1 cut(s) 123
DpnI GATC 2 cut(s) 56, 225
DpnII GATC 2 cut(s) 54, 223
Eco130I CCWWGG 1 cut(s) 282
Eco32I GATATC 1 cut(s) 178
EcoRV GATATC 1 cut(s) 178
EcoT14I CCWWGG 1 cut(s) 282
EcoT22I ATGCAT 1 cut(s) 220
ErhI CCWWGG 1 cut(s) 282
FaeI CATG 4 cut(s) 61, 158, 313, 343
FaiI YATR 8 cut(s) 59, 76, 138, 156, 200, 258, 311, 341
FatI CATG 4 cut(s) 57, 154, 309, 339
FbaI TGATCA 1 cut(s) 223
Fnu4HI GCNGC 1 cut(s) 93
Fsp4HI GCNGC 1 cut(s) 93
FspBI CTAG 1 cut(s) 364
GluI GCNGC 1 cut(s) 93
GsuI CTGGAG 1 cut(s) 162
Hin1II CATG 4 cut(s) 61, 158, 313, 343
HphI GGTGA 3 cut(s) 73, 224, 299
Hpy166II GTNNAC 1 cut(s) 361
Hpy188I TCNGA 5 cut(s) 33, 54, 126, 195, 334
Hpy8I GTNNAC 1 cut(s) 361
HpyCH4V TGCA 4 cut(s) 151, 218, 231, 327
HpyF10VI GCNNNNNNNGC 1 cut(s) 35
HpyF3I CTNAG 1 cut(s) 123
Hsp92II CATG 4 cut(s) 61, 158, 313, 343
Ksp22I TGATCA 1 cut(s) 223
Kzo9I GATC 2 cut(s) 54, 223
LpnPI CCDG 3 cut(s) 81, 96, 126
Lsp1109I GCAGC 1 cut(s) 104
LweI GCATC 2 cut(s) 160, 205
MaeI CTAG 1 cut(s) 364
MaeIII GTNAC 1 cut(s) 251
MalI GATC 2 cut(s) 56, 225
MboI GATC 2 cut(s) 54, 223
MluCI AATT 2 cut(s) 99, 163
MmeI TCCRAC 1 cut(s) 274
Mph1103I ATGCAT 1 cut(s) 220
MroXI GAANNNNTTC 1 cut(s) 131
MseI TTAA 2 cut(s) 84, 278
MslI CAYNNNNRTG 2 cut(s) 62, 344
MwoI GCNNNNNNNGC 1 cut(s) 35
NdeII GATC 2 cut(s) 54, 223
NlaIII CATG 4 cut(s) 61, 158, 313, 343
NmuCI GTSAC 1 cut(s) 251
NsiI ATGCAT 1 cut(s) 220
PdmI GAANNNNTTC 1 cut(s) 131
PkrI GCNGC 1 cut(s) 94
RseI CAYNNNNRTG 2 cut(s) 62, 344
SaqAI TTAA 2 cut(s) 84, 278
SatI GCNGC 1 cut(s) 93
Sau3AI GATC 2 cut(s) 54, 223
SetI ASST 1 cut(s) 284
SfaNI GCATC 2 cut(s) 160, 205
SmiMI CAYNNNNRTG 2 cut(s) 62, 344
Sse9I AATT 2 cut(s) 99, 163
SspMI CTAG 1 cut(s) 364
StyI CCWWGG 1 cut(s) 282
TasI AATT 2 cut(s) 99, 163
Tru1I TTAA 2 cut(s) 84, 278
Tru9I TTAA 2 cut(s) 84, 278
TscAI CASTG 3 cut(s) 12, 115, 233
TseFI GTSAC 1 cut(s) 251
TseI GCWGC 1 cut(s) 92
Tsp45I GTSAC 1 cut(s) 251
TspDTI ATGAA 4 cut(s) 158, 285, 298, 356
TspRI CASTG 3 cut(s) 12, 115, 233
XapI RAATTY 1 cut(s) 163
XmnI GAANNNNTTC 1 cut(s) 131
XspI CTAG 1 cut(s) 364
Zsp2I ATGCAT 1 cut(s) 220
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.