Rroxscaffold_4G00303230

Basic blue protein-like

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000004
Physical Location & Seq
Forward (+)
23623743 .. 23624519
777 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_4G00303230.1

Sequence Viewer

Length: 363 bp
ATGGCAGTGGCACAATACTCTGCTCTTGCTCTGATTGCGTTTCTGGTTTCTCCGATCACGGTGATGGTGAAGGCAAATTCATACGAAGTTGACTGGGCAACTGGAGTTGATTTCGCTGAGTTTGCTACTCAGAACACTTTCTTTGCTGGAGATGTATTGAATTTTCATTATGATAGTGTTCACAACAATGTGGTTATAGCAACCGATGGTGATGAATTTGATCAATGCGAGATGGAACCGAACTTGGGTTATTATCAAAGTGGCAATGAAGCATTTACCTTGGGTGAAGCTGGATACTATTATTTCATGTGCGGGTATCACTGCAAATCTGACGGCATGAAAATGTCAGTGTTTGTGAACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

120

Amino Acids

13.34

Weight (kDa)

4.08

Isoelectric Point (pI)

28.37

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Cu_bind_like PF02298 32 - 110 5e-13 Plastocyanin-like domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 312
AcsI RAATTY 3 cut(s) 76, 160, 215
AfiI CCNNNNNNNGG 1 cut(s) 245
AgsI TTSAA 1 cut(s) 160
AluBI AGCT 1 cut(s) 290
AluI AGCT 1 cut(s) 290
ApoI RAATTY 3 cut(s) 76, 160, 215
Asp700I GAANNNNTTC 1 cut(s) 137
AsuHPI GGTGA 4 cut(s) 73, 79, 221, 296
BccI CCATC 3 cut(s) 58, 200, 226
BceAI ACGGC 1 cut(s) 349
BciVI GTATCC 1 cut(s) 287
BclI TGATCA 1 cut(s) 220
BfaI CTAG 1 cut(s) 361
BfuI GTATCC 1 cut(s) 287
BmiI GGNNCC 1 cut(s) 237
BmrI ACTGGG 1 cut(s) 103
BmuI ACTGGG 1 cut(s) 103
BpmI CTGGAG 2 cut(s) 123, 168
BsaJI CCNNGG 1 cut(s) 279
Bsc4I CCNNNNNNNGG 1 cut(s) 245
Bse1I ACTGG 2 cut(s) 98, 106
Bse3DI GCAATG 1 cut(s) 271
BseDI CCNNGG 1 cut(s) 279
BseLI CCNNNNNNNGG 1 cut(s) 245
BseMI GCAATG 1 cut(s) 271
BseMII CTCAG 2 cut(s) 108, 143
BseNI ACTGG 2 cut(s) 98, 106
BslI CCNNNNNNNGG 1 cut(s) 245
Bsp143I GATC 2 cut(s) 54, 220
BspACI CCGC 1 cut(s) 312
BspCNI CTCAG 2 cut(s) 109, 142
BspLI GGNNCC 1 cut(s) 237
BsrDI GCAATG 1 cut(s) 271
BsrI ACTGG 2 cut(s) 98, 106
BssECI CCNNGG 1 cut(s) 279
BssMI GATC 2 cut(s) 54, 220
BssT1I CCWWGG 1 cut(s) 279
Bst4CI ACNGT 1 cut(s) 61
BstDEI CTNAG 2 cut(s) 117, 129
BstKTI GATC 2 cut(s) 57, 223
BstMBI GATC 2 cut(s) 54, 220
BstMWI GCNNNNNNNGC 2 cut(s) 35, 122
BsuI GTATCC 1 cut(s) 287
BtsI GCAGTG 2 cut(s) 12, 319
BtsIMutI CAGTG 3 cut(s) 12, 319, 354
CviAII CATG 2 cut(s) 307, 337
CviJI RGCY 1 cut(s) 290
CviKI_1 RGCY 1 cut(s) 290
DdeI CTNAG 2 cut(s) 117, 129
DpnI GATC 2 cut(s) 56, 222
DpnII GATC 2 cut(s) 54, 220
Eco130I CCWWGG 1 cut(s) 279
EcoT14I CCWWGG 1 cut(s) 279
ErhI CCWWGG 1 cut(s) 279
FaeI CATG 2 cut(s) 310, 340
FaiI YATR 5 cut(s) 82, 171, 197, 308, 338
FatI CATG 2 cut(s) 306, 336
FauI CCCGC 1 cut(s) 305
FbaI TGATCA 1 cut(s) 220
FspBI CTAG 1 cut(s) 361
GsuI CTGGAG 2 cut(s) 123, 168
Hin1II CATG 2 cut(s) 310, 340
HincII GTYRAC 1 cut(s) 91
HindII GTYRAC 1 cut(s) 91
HphI GGTGA 4 cut(s) 73, 79, 221, 296
Hpy166II GTNNAC 3 cut(s) 91, 181, 358
Hpy188I TCNGA 4 cut(s) 33, 54, 132, 331
Hpy8I GTNNAC 3 cut(s) 91, 181, 358
HpyAV CCTTC 1 cut(s) 64
HpyCH4III ACNGT 1 cut(s) 61
HpyCH4V TGCA 1 cut(s) 324
HpyF10VI GCNNNNNNNGC 2 cut(s) 35, 122
HpyF3I CTNAG 2 cut(s) 117, 129
Hsp92II CATG 2 cut(s) 310, 340
Ksp22I TGATCA 1 cut(s) 220
Kzo9I GATC 2 cut(s) 54, 220
LpnPI CCDG 5 cut(s) 29, 79, 87, 132, 276
MaeI CTAG 1 cut(s) 361
MalI GATC 2 cut(s) 56, 222
MboI GATC 2 cut(s) 54, 220
MluCI AATT 3 cut(s) 76, 160, 215
MroXI GAANNNNTTC 1 cut(s) 137
MslI CAYNNNNRTG 3 cut(s) 62, 186, 341
MwoI GCNNNNNNNGC 2 cut(s) 35, 122
NdeII GATC 2 cut(s) 54, 220
NlaIII CATG 2 cut(s) 310, 340
NlaIV GGNNCC 1 cut(s) 237
PdmI GAANNNNTTC 1 cut(s) 137
PspN4I GGNNCC 1 cut(s) 237
RseI CAYNNNNRTG 3 cut(s) 62, 186, 341
Sau3AI GATC 2 cut(s) 54, 220
SetI ASST 2 cut(s) 281, 292
SmiMI CAYNNNNRTG 3 cut(s) 62, 186, 341
Sse9I AATT 3 cut(s) 76, 160, 215
SsiI CCGC 1 cut(s) 312
SspMI CTAG 1 cut(s) 361
StyI CCWWGG 1 cut(s) 279
TaaI ACNGT 1 cut(s) 61
TasI AATT 3 cut(s) 76, 160, 215
TscAI CASTG 3 cut(s) 12, 326, 354
TspDTI ATGAA 6 cut(s) 69, 155, 228, 282, 295, 353
TspRI CASTG 3 cut(s) 12, 326, 354
XapI RAATTY 3 cut(s) 76, 160, 215
XmnI GAANNNNTTC 1 cut(s) 137
XspI CTAG 1 cut(s) 361
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.