Rh1DG236500

Basic blue protein-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1D
OG0007529
Physical Location & Seq
Reverse (-)
44975851 .. 44976682
832 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1DG236500.1

Sequence Viewer

Length: 357 bp
ATGGCAGTGGCACGATACTTGGCTCTTGCTCTGATTGCGTTTATCGTTTCTCCGATCATGGTGATGGCAACAACATACGACATTAACTGGGCAGCACGAATTGATTACACTGGTTTTGTTGCTCAAAACACTTTCTATGCTGGAGATGTGATAAATTTTCATTGGGATATCGCTTATCACAATCTGATTATAGCAACAGATGGTGATGCATTTGATCAGTGCAAGAATAAACCGAACTTGGGTCACTATACAAGTGGAAATGAAGCATTAACGTTGGGTGAAGTAGGATACTATTATTTCATGTGTGGGTTTGACTGCAAATCTGATGGCATGAAGATGTCGGTGTTTGTGAACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Cu_bind_like

Protein Analysis

118

Amino Acids

13.19

Weight (kDa)

4.76

Isoelectric Point (pI)

31.02

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Cu_bind_like PF02298 30 - 105 2.4e-12 Plastocyanin-like domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclI AACGTT 1 cut(s) 272
AcsI RAATTY 1 cut(s) 154
AfiI CCNNNNNNNGG 1 cut(s) 239
ApeKI GCWGC 1 cut(s) 92
ApoI RAATTY 1 cut(s) 154
AsuHPI GGTGA 3 cut(s) 73, 215, 290
BbvI GCAGC 1 cut(s) 104
BccI CCATC 3 cut(s) 58, 194, 320
BciVI GTATCC 1 cut(s) 281
BclI TGATCA 1 cut(s) 214
BfaI CTAG 1 cut(s) 355
BfuI GTATCC 1 cut(s) 281
BisI GCNGC 1 cut(s) 93
BlsI GCNGC 1 cut(s) 94
BmrI ACTGGG 1 cut(s) 97
BmsI GCATC 1 cut(s) 196
BmuI ACTGGG 1 cut(s) 97
BpmI CTGGAG 1 cut(s) 162
Bsc4I CCNNNNNNNGG 1 cut(s) 239
Bse1I ACTGG 2 cut(s) 92, 115
BseLI CCNNNNNNNGG 1 cut(s) 239
BseNI ACTGG 2 cut(s) 92, 115
BseXI GCAGC 1 cut(s) 104
BslI CCNNNNNNNGG 1 cut(s) 239
Bsp143I GATC 2 cut(s) 54, 214
BsrI ACTGG 2 cut(s) 92, 115
BssMI GATC 2 cut(s) 54, 214
BstKTI GATC 2 cut(s) 57, 217
BstMBI GATC 2 cut(s) 54, 214
BstMWI GCNNNNNNNGC 1 cut(s) 35
BstV1I GCAGC 1 cut(s) 104
BsuI GTATCC 1 cut(s) 281
BtsI GCAGTG 1 cut(s) 12
BtsIMutI CAGTG 3 cut(s) 12, 108, 224
CviAII CATG 3 cut(s) 58, 301, 331
CviJI RGCY 1 cut(s) 23
CviKI_1 RGCY 1 cut(s) 23
DpnI GATC 2 cut(s) 56, 216
DpnII GATC 2 cut(s) 54, 214
Eco32I GATATC 1 cut(s) 169
EcoRV GATATC 1 cut(s) 169
EcoT22I ATGCAT 1 cut(s) 211
FaeI CATG 3 cut(s) 61, 304, 334
FaiI YATR 7 cut(s) 59, 76, 138, 191, 249, 302, 332
FatI CATG 3 cut(s) 57, 300, 330
FbaI TGATCA 1 cut(s) 214
Fnu4HI GCNGC 1 cut(s) 93
Fsp4HI GCNGC 1 cut(s) 93
FspBI CTAG 1 cut(s) 355
GluI GCNGC 1 cut(s) 93
GsuI CTGGAG 1 cut(s) 162
Hin1II CATG 3 cut(s) 61, 304, 334
HphI GGTGA 3 cut(s) 73, 215, 290
Hpy166II GTNNAC 1 cut(s) 352
Hpy188I TCNGA 4 cut(s) 33, 54, 186, 325
Hpy8I GTNNAC 1 cut(s) 352
HpyCH4IV ACGT 1 cut(s) 272
HpyCH4V TGCA 3 cut(s) 209, 222, 318
HpyF10VI GCNNNNNNNGC 1 cut(s) 35
HpySE526I ACGT 1 cut(s) 272
Hsp92II CATG 3 cut(s) 61, 304, 334
Ksp22I TGATCA 1 cut(s) 214
Kzo9I GATC 2 cut(s) 54, 214
LpnPI CCDG 3 cut(s) 73, 96, 126
Lsp1109I GCAGC 1 cut(s) 104
LweI GCATC 1 cut(s) 196
MaeI CTAG 1 cut(s) 355
MaeII ACGT 1 cut(s) 272
MaeIII GTNAC 1 cut(s) 242
MalI GATC 2 cut(s) 56, 216
MboI GATC 2 cut(s) 54, 214
MboII GAAGA 1 cut(s) 346
MluCI AATT 2 cut(s) 99, 154
Mph1103I ATGCAT 1 cut(s) 211
MseI TTAA 2 cut(s) 84, 269
MslI CAYNNNNRTG 2 cut(s) 62, 335
MwoI GCNNNNNNNGC 1 cut(s) 35
NdeII GATC 2 cut(s) 54, 214
NlaIII CATG 3 cut(s) 61, 304, 334
NmuCI GTSAC 1 cut(s) 242
NsiI ATGCAT 1 cut(s) 211
PkrI GCNGC 1 cut(s) 94
Psp1406I AACGTT 1 cut(s) 272
RseI CAYNNNNRTG 2 cut(s) 62, 335
SaqAI TTAA 2 cut(s) 84, 269
SatI GCNGC 1 cut(s) 93
Sau3AI GATC 2 cut(s) 54, 214
SetI ASST 1 cut(s) 275
SfaNI GCATC 1 cut(s) 196
SmiMI CAYNNNNRTG 2 cut(s) 62, 335
Sse9I AATT 2 cut(s) 99, 154
SspMI CTAG 1 cut(s) 355
TaiI ACGT 1 cut(s) 275
TasI AATT 2 cut(s) 99, 154
Tru1I TTAA 2 cut(s) 84, 269
Tru9I TTAA 2 cut(s) 84, 269
TscAI CASTG 3 cut(s) 12, 115, 224
TseFI GTSAC 1 cut(s) 242
TseI GCWGC 1 cut(s) 92
Tsp45I GTSAC 1 cut(s) 242
TspDTI ATGAA 4 cut(s) 149, 276, 289, 347
TspRI CASTG 3 cut(s) 12, 115, 224
XapI RAATTY 1 cut(s) 154
XspI CTAG 1 cut(s) 355
Zsp2I ATGCAT 1 cut(s) 211
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.