RchiOBHm_Chr1g0352111

Basic blue protein-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
OG0007529
Physical Location & Seq
Reverse (-)
45319348 .. 45320333
986 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ57785

Sequence Viewer

Length: 372 bp
ATGGCAGTGGCAAAATACTCGGCTCTTGCTCTGATTGCGTTTCTGGTTTCTCCGATCATGGTGATGGTGATGGCAAATCAGTCATACGAAGTTGACTGGTCAATTGGAGTTGATTTCACTGATTTTGCTACTCAAAATACTTTCTTTGCTGGAGATGTATTAAATTTTCATTACGATAGCGCTAGTCACAATTTGCTTATAGCAACAGATAGTGATGCATTTGATCAATGCCAGATGACACCGAACTTGGGTTTTTATAAAAGTGGCAATGAAGCATTAACCTTGGTTGAACCTGGAAACTATTATTTCATGTGTGAGTATAATTGCAAATCTGATGGCATGAAGATGTCAGTGTATGTGAACAATATGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Cu_bind_like

Protein Analysis

123

Amino Acids

13.74

Weight (kDa)

4.13

Isoelectric Point (pI)

31.96

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Cu_bind_like PF02298 33 - 109 4.3e-14 Plastocyanin-like domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 258
AcsI RAATTY 1 cut(s) 163
AfeI AGCGCT 1 cut(s) 181
AfiI CCNNNNNNNGG 1 cut(s) 248
AgsI TTSAA 1 cut(s) 290
AjnI CCWGG 1 cut(s) 292
Aor51HI AGCGCT 1 cut(s) 181
ApoI RAATTY 1 cut(s) 163
AspLEI GCGC 1 cut(s) 182
AsuHPI GGTGA 2 cut(s) 73, 79
BccI CCATC 3 cut(s) 58, 64, 329
BcgI CGANNNNNNTGC 1 cut(s) 34
BciT130I CCWGG 1 cut(s) 294
BclI TGATCA 1 cut(s) 223
BfaI CTAG 1 cut(s) 183
BfoI RGCGCY 1 cut(s) 183
Bme1390I CCNGG 1 cut(s) 294
BmrFI CCNGG 1 cut(s) 294
BmsI GCATC 1 cut(s) 205
BpmI CTGGAG 1 cut(s) 171
BsaJI CCNNGG 1 cut(s) 282
Bsc4I CCNNNNNNNGG 1 cut(s) 248
Bse1I ACTGG 1 cut(s) 101
Bse3DI GCAATG 1 cut(s) 274
BseBI CCWGG 1 cut(s) 294
BseDI CCNNGG 1 cut(s) 282
BseLI CCNNNNNNNGG 1 cut(s) 248
BseMI GCAATG 1 cut(s) 274
BseNI ACTGG 1 cut(s) 101
BslI CCNNNNNNNGG 1 cut(s) 248
Bsp143I GATC 2 cut(s) 54, 223
BsrDI GCAATG 1 cut(s) 274
BsrI ACTGG 1 cut(s) 101
BssECI CCNNGG 1 cut(s) 282
BssMI GATC 2 cut(s) 54, 223
BssT1I CCWWGG 1 cut(s) 282
Bst2UI CCWGG 1 cut(s) 294
BstH2I RGCGCY 1 cut(s) 183
BstHHI GCGC 1 cut(s) 182
BstKTI GATC 2 cut(s) 57, 226
BstMBI GATC 2 cut(s) 54, 223
BstMWI GCNNNNNNNGC 1 cut(s) 35
BstNI CCWGG 1 cut(s) 294
BstSCI CCNGG 1 cut(s) 292
BtsI GCAGTG 1 cut(s) 12
BtsIMutI CAGTG 3 cut(s) 12, 117, 357
CfoI GCGC 1 cut(s) 182
CviAII CATG 3 cut(s) 58, 310, 340
CviJI RGCY 1 cut(s) 23
CviKI_1 RGCY 1 cut(s) 23
DpnI GATC 2 cut(s) 56, 225
DpnII GATC 2 cut(s) 54, 223
Eco130I CCWWGG 1 cut(s) 282
Eco47III AGCGCT 1 cut(s) 181
EcoRII CCWGG 1 cut(s) 292
EcoT14I CCWWGG 1 cut(s) 282
EcoT22I ATGCAT 1 cut(s) 220
ErhI CCWWGG 1 cut(s) 282
FaeI CATG 3 cut(s) 61, 313, 343
FaiI YATR 9 cut(s) 59, 85, 200, 258, 311, 321, 341, 357, 368
FatI CATG 3 cut(s) 57, 309, 339
FbaI TGATCA 1 cut(s) 223
FspBI CTAG 1 cut(s) 183
GlaI GCGC 1 cut(s) 181
GsuI CTGGAG 1 cut(s) 171
HaeII RGCGCY 1 cut(s) 183
HhaI GCGC 1 cut(s) 182
Hin1II CATG 3 cut(s) 61, 313, 343
Hin6I GCGC 1 cut(s) 180
HinP1I GCGC 1 cut(s) 180
HincII GTYRAC 1 cut(s) 94
HindII GTYRAC 1 cut(s) 94
HphI GGTGA 2 cut(s) 73, 79
Hpy166II GTNNAC 2 cut(s) 94, 361
Hpy188I TCNGA 3 cut(s) 33, 54, 334
Hpy8I GTNNAC 2 cut(s) 94, 361
HpyCH4V TGCA 2 cut(s) 218, 327
HpyF10VI GCNNNNNNNGC 1 cut(s) 35
Hsp92II CATG 3 cut(s) 61, 313, 343
HspAI GCGC 1 cut(s) 180
Ksp22I TGATCA 1 cut(s) 223
Kzo9I GATC 2 cut(s) 54, 223
LpnPI CCDG 6 cut(s) 29, 82, 135, 245, 279, 306
LweI GCATC 1 cut(s) 205
MaeI CTAG 1 cut(s) 183
MaeIII GTNAC 1 cut(s) 185
MalI GATC 2 cut(s) 56, 225
MboI GATC 2 cut(s) 54, 223
MboII GAAGA 1 cut(s) 355
MfeI CAATTG 1 cut(s) 102
MluCI AATT 4 cut(s) 102, 163, 190, 322
Mph1103I ATGCAT 1 cut(s) 220
MseI TTAA 2 cut(s) 161, 278
MslI CAYNNNNRTG 2 cut(s) 62, 344
MspR9I CCNGG 1 cut(s) 294
MunI CAATTG 1 cut(s) 102
MvaI CCWGG 1 cut(s) 294
MwoI GCNNNNNNNGC 1 cut(s) 35
NdeII GATC 2 cut(s) 54, 223
NlaIII CATG 3 cut(s) 61, 313, 343
NmuCI GTSAC 1 cut(s) 185
NsiI ATGCAT 1 cut(s) 220
PsiI TTATAA 1 cut(s) 258
Psp6I CCWGG 1 cut(s) 292
PspGI CCWGG 1 cut(s) 292
RseI CAYNNNNRTG 2 cut(s) 62, 344
SaqAI TTAA 2 cut(s) 161, 278
Sau3AI GATC 2 cut(s) 54, 223
ScrFI CCNGG 1 cut(s) 294
SetI ASST 2 cut(s) 284, 295
SfaNI GCATC 1 cut(s) 205
SmiMI CAYNNNNRTG 2 cut(s) 62, 344
Sse9I AATT 4 cut(s) 102, 163, 190, 322
SspMI CTAG 1 cut(s) 183
StyD4I CCNGG 1 cut(s) 292
StyI CCWWGG 1 cut(s) 282
TasI AATT 4 cut(s) 102, 163, 190, 322
Tru1I TTAA 2 cut(s) 161, 278
Tru9I TTAA 2 cut(s) 161, 278
TscAI CASTG 3 cut(s) 12, 124, 357
TseFI GTSAC 1 cut(s) 185
Tsp45I GTSAC 1 cut(s) 185
TspDTI ATGAA 4 cut(s) 158, 285, 298, 356
TspRI CASTG 3 cut(s) 12, 124, 357
XapI RAATTY 1 cut(s) 163
XspI CTAG 1 cut(s) 183
Zsp2I ATGCAT 1 cut(s) 220
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.