MD00G1151000.v1.1
ERF Family

2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr00
Physical Location & Seq
Forward (+)
33287877 .. 33288164
288 bp
Loading structure...
UTR
Exon/CDS
Intron
MD00G1151000.v1.1.491

Sequence Viewer

Length: 171 bp
ATGGAGATTTGGGTGGCCAAAACGAGGTGCCCATTTGTTCATTCCCATGATCTCCCCGACAAGGCAAAGATCGGTTTCCTTGAAGCCTATGAACCTGGTTGGACAGCTACTCATGATATGGAGTTAAGTCTAACTGAACCTGGACAGGCTGGCCAGTCAACACTCGGTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

57

Amino Acids

6.2

Weight (kDa)

5.04

Isoelectric Point (pI)

34.02

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 27
AcoI YGGCCR 2 cut(s) 15, 151
AfiI CCNNNNNNNGG 2 cut(s) 24, 61
AgsI TTSAA 1 cut(s) 83
AjnI CCWGG 2 cut(s) 94, 139
AluBI AGCT 1 cut(s) 107
AluI AGCT 1 cut(s) 107
AoxI GGCC 2 cut(s) 15, 151
BaeGI GKGCMC 1 cut(s) 32
BalI TGGCCA 2 cut(s) 17, 153
BanI GGYRCC 1 cut(s) 27
BciT130I CCWGG 2 cut(s) 96, 141
Bme1390I CCNGG 2 cut(s) 96, 141
BmiI GGNNCC 1 cut(s) 29
BmrFI CCNGG 2 cut(s) 96, 141
Bsc4I CCNNNNNNNGG 2 cut(s) 24, 61
Bse1I ACTGG 1 cut(s) 154
BseBI CCWGG 2 cut(s) 96, 141
BseLI CCNNNNNNNGG 2 cut(s) 24, 61
BseNI ACTGG 1 cut(s) 154
BseSI GKGCMC 1 cut(s) 32
BshFI GGCC 2 cut(s) 17, 153
BshNI GGYRCC 1 cut(s) 27
BslI CCNNNNNNNGG 2 cut(s) 24, 61
BsnI GGCC 2 cut(s) 17, 153
Bsp1286I GDGCHC 1 cut(s) 32
Bsp143I GATC 2 cut(s) 49, 69
BspANI GGCC 2 cut(s) 17, 153
BspHI TCATGA 1 cut(s) 112
BspLI GGNNCC 1 cut(s) 29
BspT107I GGYRCC 1 cut(s) 27
BsrI ACTGG 1 cut(s) 154
BssMI GATC 2 cut(s) 49, 69
Bst2UI CCWGG 2 cut(s) 96, 141
BstC8I GCNNGC 1 cut(s) 151
BstKTI GATC 2 cut(s) 52, 72
BstMBI GATC 2 cut(s) 49, 69
BstNI CCWGG 2 cut(s) 96, 141
BstSCI CCNGG 2 cut(s) 94, 139
BstSLI GKGCMC 1 cut(s) 32
BsuRI GGCC 2 cut(s) 17, 153
Cac8I GCNNGC 1 cut(s) 151
CciI TCATGA 1 cut(s) 112
CsiI ACCWGGT 1 cut(s) 94
CviAII CATG 2 cut(s) 47, 113
CviJI RGCY 5 cut(s) 17, 86, 107, 149, 153
CviKI_1 RGCY 5 cut(s) 17, 86, 107, 149, 153
DpnI GATC 2 cut(s) 51, 71
DpnII GATC 2 cut(s) 49, 69
EaeI YGGCCR 2 cut(s) 15, 151
EcoRII CCWGG 2 cut(s) 94, 139
FaeI CATG 2 cut(s) 50, 116
FaiI YATR 4 cut(s) 48, 90, 114, 119
FatI CATG 2 cut(s) 46, 112
HaeIII GGCC 2 cut(s) 17, 153
Hin1II CATG 2 cut(s) 50, 116
HincII GTYRAC 1 cut(s) 159
HindII GTYRAC 1 cut(s) 159
Hpy166II GTNNAC 1 cut(s) 159
Hpy188III TCNNGA 1 cut(s) 113
Hpy8I GTNNAC 1 cut(s) 159
Hsp92II CATG 2 cut(s) 50, 116
Kzo9I GATC 2 cut(s) 49, 69
LpnPI CCDG 7 cut(s) 81, 108, 126, 131, 135, 153, 167
MabI ACCWGGT 1 cut(s) 94
MalI GATC 2 cut(s) 51, 71
MboI GATC 2 cut(s) 49, 69
MhlI GDGCHC 1 cut(s) 32
MlsI TGGCCA 2 cut(s) 17, 153
MluNI TGGCCA 2 cut(s) 17, 153
MmeI TCCRAC 1 cut(s) 80
MnlI CCTC 1 cut(s) 18
Mox20I TGGCCA 2 cut(s) 17, 153
MscI TGGCCA 2 cut(s) 17, 153
MseI TTAA 2 cut(s) 125, 169
MslI CAYNNNNRTG 1 cut(s) 45
Msp20I TGGCCA 2 cut(s) 17, 153
MspR9I CCNGG 2 cut(s) 96, 141
MvaI CCWGG 2 cut(s) 96, 141
NdeII GATC 2 cut(s) 49, 69
NlaIII CATG 2 cut(s) 50, 116
NlaIV GGNNCC 1 cut(s) 29
PagI TCATGA 1 cut(s) 112
Psp6I CCWGG 2 cut(s) 94, 139
PspGI CCWGG 2 cut(s) 94, 139
PspN4I GGNNCC 1 cut(s) 29
RseI CAYNNNNRTG 1 cut(s) 45
SaqAI TTAA 2 cut(s) 125, 169
Sau3AI GATC 2 cut(s) 49, 69
ScrFI CCNGG 2 cut(s) 96, 141
SduI GDGCHC 1 cut(s) 32
SetI ASST 4 cut(s) 29, 97, 109, 142
SexAI ACCWGGT 1 cut(s) 94
SmiMI CAYNNNNRTG 1 cut(s) 45
StyD4I CCNGG 2 cut(s) 94, 139
Tru1I TTAA 2 cut(s) 125, 169
Tru9I TTAA 2 cut(s) 125, 169
TspDTI ATGAA 2 cut(s) 29, 105
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.