MD00G1151300.v1.1

divergent subfamily of APPLE domains

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr00
Physical Location & Seq
Forward (+)
33290517 .. 33291080
564 bp
Loading structure...
UTR
Exon/CDS
Intron
MD00G1151300.v1.1.491

Sequence Viewer

Length: 198 bp
ATGTCCCCAGAATATGCGATCGATGGGTTCTACTTGATAAAATCTGACATGTATAGCTTTGGTGTTATGGTGCTTGAGATAGTGAAGGGAAAAGAAACAGAGGATTTTCTCATCCAAACCACAGCCTTAACTTGCATGGACATGCATGGAATTTATACACAGAAGGCAAGTCCATTGAAATGCTCGATACATGAGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.

Protein Analysis

66

Amino Acids

7.37

Weight (kDa)

4.91

Isoelectric Point (pI)

56.22

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 150
AflIII ACRYGT 1 cut(s) 48
AgsI TTSAA 1 cut(s) 178
AluBI AGCT 1 cut(s) 57
AluI AGCT 1 cut(s) 57
ApoI RAATTY 1 cut(s) 150
BaeI ACNNNNGTAYC 1 cut(s) 179
BccI CCATC 1 cut(s) 17
BpuEI CTTGAG 1 cut(s) 95
Bsa29I ATCGAT 1 cut(s) 21
BseCI ATCGAT 1 cut(s) 21
BseGI GGATG 1 cut(s) 111
Bsh1285I CGRYCG 1 cut(s) 21
BshVI ATCGAT 1 cut(s) 21
BsiEI CGRYCG 1 cut(s) 21
Bsp143I GATC 1 cut(s) 18
BspDI ATCGAT 1 cut(s) 21
BssMI GATC 1 cut(s) 18
BstF5I GGATG 1 cut(s) 111
BstKTI GATC 1 cut(s) 21
BstMBI GATC 1 cut(s) 18
BstMCI CGRYCG 1 cut(s) 21
BstNSI RCATGY 2 cut(s) 52, 145
Bsu15I ATCGAT 1 cut(s) 21
BsuTUI ATCGAT 1 cut(s) 21
BtsCI GGATG 1 cut(s) 111
ClaI ATCGAT 1 cut(s) 21
CviAII CATG 5 cut(s) 49, 136, 142, 146, 191
CviJI RGCY 2 cut(s) 57, 125
CviKI_1 RGCY 2 cut(s) 57, 125
DpnI GATC 1 cut(s) 20
DpnII GATC 1 cut(s) 18
EcoT22I ATGCAT 1 cut(s) 147
FaeI CATG 5 cut(s) 52, 139, 145, 149, 194
FaiI YATR 9 cut(s) 15, 50, 54, 68, 137, 143, 147, 156, 192
FatI CATG 5 cut(s) 48, 135, 141, 145, 190
FokI GGATG 1 cut(s) 98
Hin1II CATG 5 cut(s) 52, 139, 145, 149, 194
Hpy188I TCNGA 1 cut(s) 46
HpyAV CCTTC 2 cut(s) 79, 157
HpyCH4V TGCA 2 cut(s) 135, 145
Hsp92II CATG 5 cut(s) 52, 139, 145, 149, 194
Kzo9I GATC 1 cut(s) 18
LpnPI CCDG 1 cut(s) 21
MalI GATC 1 cut(s) 20
MboI GATC 1 cut(s) 18
MluCI AATT 1 cut(s) 150
MnlI CCTC 1 cut(s) 94
Mph1103I ATGCAT 1 cut(s) 147
MseI TTAA 1 cut(s) 128
MslI CAYNNNNRTG 2 cut(s) 140, 178
NdeII GATC 1 cut(s) 18
NlaIII CATG 5 cut(s) 52, 139, 145, 149, 194
NsiI ATGCAT 1 cut(s) 147
NspI RCATGY 2 cut(s) 52, 145
PciI ACATGT 1 cut(s) 48
Ple19I CGATCG 1 cut(s) 21
PscI ACATGT 1 cut(s) 48
PvuI CGATCG 1 cut(s) 21
RseI CAYNNNNRTG 2 cut(s) 140, 178
SaqAI TTAA 1 cut(s) 128
Sau3AI GATC 1 cut(s) 18
SetI ASST 1 cut(s) 59
SgeI CNNG 9 cut(s) 20, 46, 61, 86, 144, 148, 154, 158, 180
SmiMI CAYNNNNRTG 2 cut(s) 140, 178
SmlI CTYRAG 1 cut(s) 74
SmoI CTYRAG 1 cut(s) 74
Sse9I AATT 1 cut(s) 150
TaqI TCGA 2 cut(s) 21, 185
TasI AATT 1 cut(s) 150
Tru1I TTAA 1 cut(s) 128
Tru9I TTAA 1 cut(s) 128
XapI RAATTY 1 cut(s) 150
XceI RCATGY 2 cut(s) 52, 145
Zsp2I ATGCAT 1 cut(s) 147
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.