MD05G1231600.v1.1

serine threonine-protein kinase

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr05
Physical Location & Seq
Forward (+)
36484879 .. 36486489
1611 bp
Loading structure...
UTR
Exon/CDS
Intron
MD05G1231600.v1.1.491

Sequence Viewer

Length: 231 bp
ATGTCCCCAGAATATGCGATCGATGGGTTCTACTTGATAAAATCTGACATGTATAGCTTTGGTGTTATGGTGCTTGAGATAGTGAAGGGAAAAGAAACGGAGGATTTTCTCATCCAGACCACAGCCTCAACCTGCATGGACATTCTACTTCGGATTGAAGACAACTTTCTCAGTTTCACACTTTGGAGAACAATTTGTCTTCCCACGCACCCGACTATTCAACAATTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.

Protein Analysis

77

Amino Acids

8.82

Weight (kDa)

4.45

Isoelectric Point (pI)

61.05

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 140
AflIII ACRYGT 1 cut(s) 48
AgsI TTSAA 2 cut(s) 158, 221
AluBI AGCT 1 cut(s) 57
AluI AGCT 1 cut(s) 57
BbsI GAAGAC 2 cut(s) 165, 191
BccI CCATC 1 cut(s) 17
BfuAI ACCTGC 1 cut(s) 140
BpiI GAAGAC 2 cut(s) 165, 191
BpuEI CTTGAG 1 cut(s) 95
Bsa29I ATCGAT 1 cut(s) 21
BseCI ATCGAT 1 cut(s) 21
BseGI GGATG 1 cut(s) 111
BseMII CTCAG 1 cut(s) 184
Bsh1285I CGRYCG 1 cut(s) 21
BshVI ATCGAT 1 cut(s) 21
BsiEI CGRYCG 1 cut(s) 21
Bsp143I GATC 1 cut(s) 18
BspCNI CTCAG 1 cut(s) 183
BspDI ATCGAT 1 cut(s) 21
BspMI ACCTGC 1 cut(s) 140
BssMI GATC 1 cut(s) 18
BstDEI CTNAG 1 cut(s) 170
BstF5I GGATG 1 cut(s) 111
BstKTI GATC 1 cut(s) 21
BstMBI GATC 1 cut(s) 18
BstMCI CGRYCG 1 cut(s) 21
BstNSI RCATGY 1 cut(s) 52
BstV2I GAAGAC 2 cut(s) 165, 191
Bsu15I ATCGAT 1 cut(s) 21
BsuTUI ATCGAT 1 cut(s) 21
BtsCI GGATG 1 cut(s) 111
BveI ACCTGC 1 cut(s) 140
ClaI ATCGAT 1 cut(s) 21
CviAII CATG 2 cut(s) 49, 136
CviJI RGCY 2 cut(s) 57, 125
CviKI_1 RGCY 2 cut(s) 57, 125
DdeI CTNAG 1 cut(s) 170
DpnI GATC 1 cut(s) 20
DpnII GATC 1 cut(s) 18
FaeI CATG 2 cut(s) 52, 139
FaiI YATR 5 cut(s) 15, 50, 54, 68, 137
FatI CATG 2 cut(s) 48, 135
FokI GGATG 1 cut(s) 98
Hin1II CATG 2 cut(s) 52, 139
Hpy188I TCNGA 2 cut(s) 46, 153
Hpy188III TCNNGA 1 cut(s) 115
HpyAV CCTTC 1 cut(s) 79
HpyCH4V TGCA 1 cut(s) 135
HpyF3I CTNAG 1 cut(s) 170
Hsp92II CATG 2 cut(s) 52, 139
Kzo9I GATC 1 cut(s) 18
LpnPI CCDG 3 cut(s) 21, 128, 145
MalI GATC 1 cut(s) 20
MboI GATC 1 cut(s) 18
MboII GAAGA 2 cut(s) 170, 191
MluCI AATT 2 cut(s) 192, 224
MnlI CCTC 2 cut(s) 94, 136
NdeII GATC 1 cut(s) 18
NlaIII CATG 2 cut(s) 52, 139
NspI RCATGY 1 cut(s) 52
PciI ACATGT 1 cut(s) 48
Ple19I CGATCG 1 cut(s) 21
PscI ACATGT 1 cut(s) 48
PvuI CGATCG 1 cut(s) 21
Sau3AI GATC 1 cut(s) 18
SetI ASST 2 cut(s) 59, 134
SgeI CNNG 9 cut(s) 20, 46, 61, 86, 127, 144, 148, 217, 223
SmlI CTYRAG 1 cut(s) 74
SmoI CTYRAG 1 cut(s) 74
Sse9I AATT 2 cut(s) 192, 224
TaqI TCGA 1 cut(s) 21
TasI AATT 2 cut(s) 192, 224
TspGWI ACGGA 1 cut(s) 113
XceI RCATGY 1 cut(s) 52
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.