MD01G1029500.v1.1

No description available

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr01
Physical Location & Seq
Reverse (-)
10699273 .. 10699964
692 bp
Loading structure...
UTR
Exon/CDS
Intron
MD01G1029500.v1.1.491

Sequence Viewer

Length: 141 bp
ATGGATGAGACCATGAAGCAATTCCAAAAAAGCTTAATTGAACTCGAGACTGAAGCTGAGCATCTCCTCCTAGCTCGGAACCAGGTAATTTATACCTCTAGCTTCTCCTTTATAGGCTTATGGTTGAAAATGACAGGGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

47

Amino Acids

5.38

Weight (kDa)

5.05

Isoelectric Point (pI)

37.73

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 72
AgsI TTSAA 2 cut(s) 41, 127
AjnI CCWGG 1 cut(s) 81
AluBI AGCT 4 cut(s) 33, 56, 74, 102
AluI AGCT 4 cut(s) 33, 56, 74, 102
Alw26I GTCTC 2 cut(s) 2, 41
Ama87I CYCGRG 1 cut(s) 44
Asp700I GAANNNNTTC 1 cut(s) 20
AvaI CYCGRG 1 cut(s) 44
BciT130I CCWGG 1 cut(s) 83
BcoDI GTCTC 2 cut(s) 2, 41
BfaI CTAG 2 cut(s) 71, 99
BlpI GCTNAGC 1 cut(s) 57
Bme1390I CCNGG 1 cut(s) 83
BmeT110I CYCGRG 1 cut(s) 44
BmiI GGNNCC 1 cut(s) 80
BmrFI CCNGG 1 cut(s) 83
BmsI GCATC 1 cut(s) 70
Bpu1102I GCTNAGC 1 cut(s) 57
BsaI GGTCTC 1 cut(s) 2
BseBI CCWGG 1 cut(s) 83
BseGI GGATG 1 cut(s) 10
BseMII CTCAG 1 cut(s) 48
BseRI GAGGAG 1 cut(s) 56
BsiHKCI CYCGRG 1 cut(s) 44
BsmAI GTCTC 2 cut(s) 2, 41
Bso31I GGTCTC 1 cut(s) 2
BsoBI CYCGRG 1 cut(s) 44
Bsp1720I GCTNAGC 1 cut(s) 57
BspCNI CTCAG 1 cut(s) 49
BspLI GGNNCC 1 cut(s) 80
BspTNI GGTCTC 1 cut(s) 2
Bst2UI CCWGG 1 cut(s) 83
BstDEI CTNAG 1 cut(s) 57
BstF5I GGATG 1 cut(s) 10
BstMAI GTCTC 2 cut(s) 2, 41
BstNI CCWGG 1 cut(s) 83
BstSCI CCNGG 1 cut(s) 81
BtsCI GGATG 1 cut(s) 10
CsiI ACCWGGT 1 cut(s) 81
CviAII CATG 1 cut(s) 13
CviJI RGCY 5 cut(s) 33, 56, 74, 102, 117
CviKI_1 RGCY 5 cut(s) 33, 56, 74, 102, 117
DdeI CTNAG 1 cut(s) 57
Eco31I GGTCTC 1 cut(s) 2
Eco57I CTGAAG 1 cut(s) 72
Eco88I CYCGRG 1 cut(s) 44
EcoRII CCWGG 1 cut(s) 81
FaeI CATG 1 cut(s) 16
FaiI YATR 4 cut(s) 14, 93, 113, 121
FatI CATG 1 cut(s) 12
FokI GGATG 1 cut(s) 17
FspBI CTAG 2 cut(s) 71, 99
Hin1II CATG 1 cut(s) 16
HindIII AAGCTT 1 cut(s) 31
Hpy188I TCNGA 1 cut(s) 78
Hpy188III TCNNGA 1 cut(s) 46
HpyF3I CTNAG 1 cut(s) 57
Hsp92II CATG 1 cut(s) 16
LpnPI CCDG 3 cut(s) 68, 95, 120
LweI GCATC 1 cut(s) 70
MabI ACCWGGT 1 cut(s) 81
MaeI CTAG 2 cut(s) 71, 99
MluCI AATT 3 cut(s) 20, 36, 87
MnlI CCTC 2 cut(s) 77, 106
MroXI GAANNNNTTC 1 cut(s) 20
MseI TTAA 1 cut(s) 35
MspR9I CCNGG 1 cut(s) 83
MvaI CCWGG 1 cut(s) 83
NlaIII CATG 1 cut(s) 16
NlaIV GGNNCC 1 cut(s) 80
PaeR7I CTCGAG 1 cut(s) 44
PdmI GAANNNNTTC 1 cut(s) 20
Psp6I CCWGG 1 cut(s) 81
PspGI CCWGG 1 cut(s) 81
PspN4I GGNNCC 1 cut(s) 80
SaqAI TTAA 1 cut(s) 35
ScrFI CCNGG 1 cut(s) 83
SetI ASST 6 cut(s) 35, 58, 76, 87, 98, 104
SexAI ACCWGGT 1 cut(s) 81
SfaNI GCATC 1 cut(s) 70
Sfr274I CTCGAG 1 cut(s) 44
SgeI CNNG 8 cut(s) 25, 56, 58, 83, 87, 94, 95, 111
SlaI CTCGAG 1 cut(s) 44
SmlI CTYRAG 1 cut(s) 44
SmoI CTYRAG 1 cut(s) 44
Sse9I AATT 3 cut(s) 20, 36, 87
SspMI CTAG 2 cut(s) 71, 99
StyD4I CCNGG 1 cut(s) 81
TaqI TCGA 1 cut(s) 45
TasI AATT 3 cut(s) 20, 36, 87
Tru1I TTAA 1 cut(s) 35
Tru9I TTAA 1 cut(s) 35
TspDTI ATGAA 1 cut(s) 29
XhoI CTCGAG 1 cut(s) 44
XmnI GAANNNNTTC 1 cut(s) 20
XspI CTAG 2 cut(s) 71, 99
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.