Rorug01G0195200

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000001
OG0003173
Physical Location & Seq
Forward (+)
27411892 .. 27412592
701 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug01G0195200.1

Sequence Viewer

Length: 171 bp
ATGGAGTCTTTGCAAAAGCTCTTGCTTTCCATGAACAACACCATGGGGTTTTGTGATTTTGGTTCCAGAATGTTGGTGGGGATGAAAACTTGGCCCTTGAAACTCTTTGCTCCGGTTAGCGAAAAGGAAAAGCTTTCACAGATGACAGCAGCTAGCTACCAGCAGATTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

56

Amino Acids

6.36

Weight (kDa)

8.98

Isoelectric Point (pI)

29.52

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 1 cut(s) 100
AluBI AGCT 4 cut(s) 19, 133, 152, 156
AluI AGCT 4 cut(s) 19, 133, 152, 156
AoxI GGCC 1 cut(s) 92
ApeKI GCWGC 1 cut(s) 149
AspS9I GGNCC 1 cut(s) 93
AsuNHI GCTAGC 1 cut(s) 152
BbvI GCAGC 1 cut(s) 161
BfaI CTAG 1 cut(s) 153
BisI GCNGC 1 cut(s) 150
BlsI GCNGC 1 cut(s) 151
BmgT120I GGNCC 1 cut(s) 93
BmiI GGNNCC 1 cut(s) 64
BmtI GCTAGC 1 cut(s) 156
BsaJI CCNNGG 1 cut(s) 42
BsaWI WCCGGW 1 cut(s) 112
BseDI CCNNGG 1 cut(s) 42
BseGI GGATG 1 cut(s) 87
BseXI GCAGC 1 cut(s) 161
BshFI GGCC 1 cut(s) 94
BsiSI CCGG 1 cut(s) 113
BsnI GGCC 1 cut(s) 94
Bsp19I CCATGG 1 cut(s) 42
BspANI GGCC 1 cut(s) 94
BspLI GGNNCC 1 cut(s) 64
BspOI GCTAGC 1 cut(s) 156
BssECI CCNNGG 1 cut(s) 42
BssT1I CCWWGG 1 cut(s) 42
BstC8I GCNNGC 1 cut(s) 154
BstDSI CCRYGG 1 cut(s) 42
BstF5I GGATG 1 cut(s) 87
BstV1I GCAGC 1 cut(s) 161
BstXI CCANNNNNNTGG 1 cut(s) 73
BsuRI GGCC 1 cut(s) 94
BtgI CCRYGG 1 cut(s) 42
BtsCI GGATG 1 cut(s) 87
Cac8I GCNNGC 1 cut(s) 154
Cfr13I GGNCC 1 cut(s) 93
CviAII CATG 2 cut(s) 31, 43
CviJI RGCY 5 cut(s) 19, 94, 133, 152, 156
CviKI_1 RGCY 5 cut(s) 19, 94, 133, 152, 156
Eco130I CCWWGG 1 cut(s) 42
EcoT14I CCWWGG 1 cut(s) 42
ErhI CCWWGG 1 cut(s) 42
FaeI CATG 2 cut(s) 34, 46
FaiI YATR 2 cut(s) 32, 44
FatI CATG 2 cut(s) 30, 42
Fnu4HI GCNGC 1 cut(s) 150
FokI GGATG 1 cut(s) 94
Fsp4HI GCNGC 1 cut(s) 150
FspBI CTAG 1 cut(s) 153
GluI GCNGC 1 cut(s) 150
HaeIII GGCC 1 cut(s) 94
HapII CCGG 1 cut(s) 113
Hin1II CATG 2 cut(s) 34, 46
HindIII AAGCTT 1 cut(s) 131
HinfI GANTC 1 cut(s) 5
HpaII CCGG 1 cut(s) 113
Hpy188III TCNNGA 1 cut(s) 66
HpyCH4V TGCA 1 cut(s) 13
Hsp92II CATG 2 cut(s) 34, 46
LmnI GCTCC 1 cut(s) 115
LpnPI CCDG 2 cut(s) 79, 126
Lsp1109I GCAGC 1 cut(s) 161
MaeI CTAG 1 cut(s) 153
MlyI GAGTC 1 cut(s) 14
MseI TTAA 1 cut(s) 169
MspI CCGG 1 cut(s) 113
NcoI CCATGG 1 cut(s) 42
NheI GCTAGC 1 cut(s) 152
NlaIII CATG 2 cut(s) 34, 46
NlaIV GGNNCC 1 cut(s) 64
PkrI GCNGC 1 cut(s) 151
PleI GAGTC 1 cut(s) 13
PpsI GAGTC 1 cut(s) 13
PspN4I GGNNCC 1 cut(s) 64
PspPI GGNCC 1 cut(s) 93
SaqAI TTAA 1 cut(s) 169
SatI GCNGC 1 cut(s) 150
Sau96I GGNCC 1 cut(s) 93
SchI GAGTC 1 cut(s) 14
SetI ASST 4 cut(s) 21, 135, 154, 158
SgeI CNNG 8 cut(s) 34, 43, 55, 78, 102, 109, 125, 165
SspMI CTAG 1 cut(s) 153
StyI CCWWGG 1 cut(s) 42
Tru1I TTAA 1 cut(s) 169
Tru9I TTAA 1 cut(s) 169
TseI GCWGC 1 cut(s) 149
TspDTI ATGAA 2 cut(s) 47, 98
XcmI CCANNNNNNNNNTGG 1 cut(s) 73
XspI CTAG 1 cut(s) 153
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.