MD06G1074200.v1.1

Protein cornichon homolog

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr06
OG0002446
Physical Location & Seq
Reverse (-)
18544718 .. 18557020
12303 bp
Loading structure...
UTR
Exon/CDS
Intron
MD06G1074200.v1.1.491

Sequence Viewer

Length: 411 bp
ATGGGAGATCTCTACGTTTGGCTCATCTCCTTCTTCTTCCTCATTGCCCTGCTCGCCCTTGTTGTTTTCCAGCTGATGTGCCTGGCGGATCTTGAGTTCGATTATATCAACCCTTATGACTCTTCAAATCGGATAAACAGAGTGATTTTGCCAGAGTATATTACAGGAGGAGTTTTGTGCGCTTTCTTTCTTATAACAGGGCATTGGTGCATGTCACTGTTTTGTGGTCCATACCTCTATTATAATGTGAAACTGTATATGAGAAAAAATCACCTGGTAGATGTTACTGAGATATTCAATATGCTCCACAAAGAAAAGAAGATCCGGCTTTTCAAACTCTTTTATTTTGTCTTCCTCCTGTTTCTCTCGATATTCTGGATGATTCTAACTGCATTGGAAGACCGTGAATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Cornichon

Protein Analysis

137

Amino Acids

16.32

Weight (kDa)

6.27

Isoelectric Point (pI)

35.73

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Cornichon PF03311 6 - 125 9.2e-42 Cornichon protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 2 cut(s) 194, 243
AciI CCGC 1 cut(s) 86
AclWI GGATC 2 cut(s) 96, 316
AgsI TTSAA 3 cut(s) 126, 298, 334
AjnI CCWGG 2 cut(s) 81, 273
AloI GAACNNNNNNTCC 2 cut(s) 80, 112
AluBI AGCT 1 cut(s) 73
AluI AGCT 1 cut(s) 73
AlwI GGATC 2 cut(s) 96, 316
AspLEI GCGC 1 cut(s) 182
AspS9I GGNCC 1 cut(s) 227
AsuHPI GGTGA 1 cut(s) 263
AvaII GGWCC 1 cut(s) 227
BbsI GAAGAC 2 cut(s) 343, 405
BciT130I CCWGG 2 cut(s) 83, 275
BglII AGATCT 1 cut(s) 7
Bme1390I CCNGG 2 cut(s) 83, 275
Bme18I GGWCC 1 cut(s) 227
BmgT120I GGNCC 1 cut(s) 227
BmrFI CCNGG 2 cut(s) 83, 275
BpiI GAAGAC 2 cut(s) 343, 405
BpuEI CTTGAG 1 cut(s) 113
Bse3DI GCAATG 1 cut(s) 42
BseBI CCWGG 2 cut(s) 83, 275
BseGI GGATG 1 cut(s) 384
BseMI GCAATG 1 cut(s) 42
BseMII CTCAG 1 cut(s) 279
BseRI GAGGAG 1 cut(s) 183
BsiSI CCGG 1 cut(s) 325
Bsp143I GATC 3 cut(s) 7, 88, 321
BspACI CCGC 1 cut(s) 86
BspCNI CTCAG 1 cut(s) 280
BspPI GGATC 2 cut(s) 96, 316
BsrDI GCAATG 1 cut(s) 42
BssMI GATC 3 cut(s) 7, 88, 321
Bst2UI CCWGG 2 cut(s) 83, 275
Bst4CI ACNGT 3 cut(s) 219, 255, 404
Bst6I CTCTTC 1 cut(s) 127
BstC8I GCNNGC 1 cut(s) 54
BstDEI CTNAG 1 cut(s) 288
BstF5I GGATG 1 cut(s) 384
BstHHI GCGC 1 cut(s) 182
BstKTI GATC 3 cut(s) 10, 91, 324
BstMBI GATC 3 cut(s) 7, 88, 321
BstMWI GCNNNNNNNGC 1 cut(s) 53
BstNI CCWGG 2 cut(s) 83, 275
BstNSI RCATGY 1 cut(s) 214
BstSCI CCNGG 2 cut(s) 81, 273
BstV2I GAAGAC 2 cut(s) 343, 405
BstX2I RGATCY 3 cut(s) 7, 88, 321
BstYI RGATCY 3 cut(s) 7, 88, 321
BtsCI GGATG 1 cut(s) 384
BtsIMutI CAGTG 1 cut(s) 215
Cac8I GCNNGC 1 cut(s) 54
CfoI GCGC 1 cut(s) 182
Cfr13I GGNCC 1 cut(s) 227
CsiI ACCWGGT 1 cut(s) 273
CviAII CATG 1 cut(s) 211
CviJI RGCY 3 cut(s) 22, 73, 328
CviKI_1 RGCY 3 cut(s) 22, 73, 328
DdeI CTNAG 1 cut(s) 288
DpnI GATC 3 cut(s) 9, 90, 323
DpnII GATC 3 cut(s) 7, 88, 321
Eam1104I CTCTTC 1 cut(s) 127
EarI CTCTTC 1 cut(s) 127
EciI GGCGGA 1 cut(s) 101
Eco47I GGWCC 1 cut(s) 227
EcoRII CCWGG 2 cut(s) 81, 273
FaeI CATG 1 cut(s) 214
FatI CATG 1 cut(s) 210
FokI GGATG 1 cut(s) 391
GlaI GCGC 1 cut(s) 181
HapII CCGG 1 cut(s) 325
HhaI GCGC 1 cut(s) 182
Hin1II CATG 1 cut(s) 214
Hin6I GCGC 1 cut(s) 180
HinP1I GCGC 1 cut(s) 180
HinfI GANTC 2 cut(s) 119, 382
HpaII CCGG 1 cut(s) 325
HphI GGTGA 1 cut(s) 263
Hpy188I TCNGA 1 cut(s) 132
Hpy188III TCNNGA 3 cut(s) 92, 367, 376
HpyAV CCTTC 1 cut(s) 40
HpyCH4III ACNGT 3 cut(s) 219, 255, 404
HpyCH4IV ACGT 1 cut(s) 15
HpyCH4V TGCA 2 cut(s) 210, 392
HpyF10VI GCNNNNNNNGC 1 cut(s) 53
HpyF3I CTNAG 1 cut(s) 288
HpySE526I ACGT 1 cut(s) 15
Hsp92II CATG 1 cut(s) 214
HspAI GCGC 1 cut(s) 180
Kzo9I GATC 3 cut(s) 7, 88, 321
LmnI GCTCC 1 cut(s) 309
MabI ACCWGGT 1 cut(s) 273
MaeII ACGT 1 cut(s) 15
MaeIII GTNAC 2 cut(s) 213, 283
MalI GATC 3 cut(s) 9, 90, 323
MboI GATC 3 cut(s) 7, 88, 321
MboII GAAGA 6 cut(s) 25, 28, 114, 331, 343, 410
MflI RGATCY 3 cut(s) 7, 88, 321
MlyI GAGTC 1 cut(s) 113
MnlI CCTC 4 cut(s) 50, 161, 245, 365
MspA1I CMGCKG 1 cut(s) 73
MspI CCGG 1 cut(s) 325
MspR9I CCNGG 2 cut(s) 83, 275
MvaI CCWGG 2 cut(s) 83, 275
MwoI GCNNNNNNNGC 1 cut(s) 53
NdeII GATC 3 cut(s) 7, 88, 321
NlaIII CATG 1 cut(s) 214
NmuCI GTSAC 1 cut(s) 213
NspI RCATGY 1 cut(s) 214
PfeI GAWTC 1 cut(s) 382
PleI GAGTC 1 cut(s) 113
PpsI GAGTC 1 cut(s) 113
PsiI TTATAA 2 cut(s) 194, 243
Psp6I CCWGG 2 cut(s) 81, 273
PspGI CCWGG 2 cut(s) 81, 273
PspPI GGNCC 1 cut(s) 227
PsuI RGATCY 3 cut(s) 7, 88, 321
PvuII CAGCTG 1 cut(s) 73
Sau3AI GATC 3 cut(s) 7, 88, 321
Sau96I GGNCC 1 cut(s) 227
SchI GAGTC 1 cut(s) 113
ScrFI CCNGG 2 cut(s) 83, 275
SetI ASST 4 cut(s) 18, 75, 237, 276
SexAI ACCWGGT 1 cut(s) 273
SinI GGWCC 1 cut(s) 227
SmlI CTYRAG 1 cut(s) 92
SmoI CTYRAG 1 cut(s) 92
SsiI CCGC 1 cut(s) 86
StyD4I CCNGG 2 cut(s) 81, 273
TaaI ACNGT 3 cut(s) 219, 255, 404
TaiI ACGT 1 cut(s) 18
TaqI TCGA 2 cut(s) 99, 368
TfiI GAWTC 1 cut(s) 382
TscAI CASTG 1 cut(s) 222
TseFI GTSAC 1 cut(s) 213
Tsp45I GTSAC 1 cut(s) 213
TspRI CASTG 1 cut(s) 222
VpaK11BI GGWCC 1 cut(s) 227
XceI RCATGY 1 cut(s) 214
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.