Rmu_sc0010648.1_g000002

Protein cornichon homolog

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0010648.1
Physical Location & Seq
Reverse (-)
3262 .. 4418
1157 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0010648.1_g000002.1.cds

Sequence Viewer

Length: 336 bp
atgtgcttagcagatctagagtttgattatatcaacccttatgactcttcaacacggattaacagagtgattttgcccgagtacatcctagaaggactattaggtgccatctatcttatgacagggcattggatcatggcactattctgtggtccatacctctattataacgtgaaactgtatacgagtaaaaggcacctcgtagaggttactgagatattcaatatgctccacaaagagaagaagcaacgacttttcaaactcttctatcttgttttccttctctttctctcaatattctggatgattctaactgcattggacgaccacgagtaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

111

Amino Acids

13.34

Weight (kDa)

6.05

Isoelectric Point (pI)

38.82

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 168
AccB1I GGYRCC 2 cut(s) 104, 195
AccI GTMKAC 1 cut(s) 182
AclWI GGATC 1 cut(s) 140
AfaI GTAC 1 cut(s) 83
AfiI CCNNNNNNNGG 1 cut(s) 205
AgsI TTSAA 3 cut(s) 51, 223, 259
AlwI GGATC 1 cut(s) 140
Ama87I CYCGRG 1 cut(s) 77
AspS9I GGNCC 1 cut(s) 152
AvaI CYCGRG 1 cut(s) 77
AvaII GGWCC 1 cut(s) 152
BanI GGYRCC 2 cut(s) 104, 195
BauI CACGAG 1 cut(s) 329
BccI CCATC 1 cut(s) 116
BfaI CTAG 2 cut(s) 17, 89
BglII AGATCT 1 cut(s) 13
BlpI GCTNAGC 1 cut(s) 7
Bme18I GGWCC 1 cut(s) 152
BmeT110I CYCGRG 1 cut(s) 77
BmgT120I GGNCC 1 cut(s) 152
BmiI GGNNCC 2 cut(s) 106, 197
Bpu1102I GCTNAGC 1 cut(s) 7
Bsc4I CCNNNNNNNGG 1 cut(s) 205
BseGI GGATG 2 cut(s) 84, 309
BseLI CCNNNNNNNGG 1 cut(s) 205
BseMII CTCAG 1 cut(s) 204
BshNI GGYRCC 2 cut(s) 104, 195
BsiHKCI CYCGRG 1 cut(s) 77
BslI CCNNNNNNNGG 1 cut(s) 205
BsoBI CYCGRG 1 cut(s) 77
Bsp143I GATC 2 cut(s) 13, 132
Bsp1720I GCTNAGC 1 cut(s) 7
BspCNI CTCAG 1 cut(s) 205
BspLI GGNNCC 2 cut(s) 106, 197
BspPI GGATC 1 cut(s) 140
BspT107I GGYRCC 2 cut(s) 104, 195
BssMI GATC 2 cut(s) 13, 132
BssNAI GTATAC 1 cut(s) 183
BssSI CACGAG 1 cut(s) 329
Bst1107I GTATAC 1 cut(s) 183
Bst2BI CACGAG 1 cut(s) 329
Bst4CI ACNGT 1 cut(s) 180
Bst6I CTCTTC 2 cut(s) 52, 269
BstDEI CTNAG 2 cut(s) 7, 213
BstENI CCTNNNNNAGG 1 cut(s) 203
BstF5I GGATG 2 cut(s) 84, 309
BstKTI GATC 2 cut(s) 16, 135
BstMBI GATC 2 cut(s) 13, 132
BstX2I RGATCY 1 cut(s) 13
BstYI RGATCY 1 cut(s) 13
BstZ17I GTATAC 1 cut(s) 183
BtsCI GGATG 2 cut(s) 84, 309
Cfr13I GGNCC 1 cut(s) 152
Csp6I GTAC 1 cut(s) 82
CviAII CATG 1 cut(s) 136
CviQI GTAC 1 cut(s) 82
DdeI CTNAG 2 cut(s) 7, 213
DpnI GATC 2 cut(s) 15, 134
DpnII GATC 2 cut(s) 13, 132
Eam1104I CTCTTC 2 cut(s) 52, 269
EarI CTCTTC 2 cut(s) 52, 269
Eco47I GGWCC 1 cut(s) 152
Eco88I CYCGRG 1 cut(s) 77
EcoNI CCTNNNNNAGG 1 cut(s) 203
FaeI CATG 1 cut(s) 139
FaiI YATR 8 cut(s) 30, 42, 119, 137, 157, 168, 183, 227
FatI CATG 1 cut(s) 135
FblI GTMKAC 1 cut(s) 182
FokI GGATG 2 cut(s) 71, 316
FspBI CTAG 2 cut(s) 17, 89
Hin1II CATG 1 cut(s) 139
HinfI GANTC 2 cut(s) 44, 307
Hpy166II GTNNAC 1 cut(s) 183
Hpy188III TCNNGA 2 cut(s) 17, 301
Hpy8I GTNNAC 1 cut(s) 183
HpyAV CCTTC 2 cut(s) 86, 290
HpyCH4III ACNGT 1 cut(s) 180
HpyCH4IV ACGT 1 cut(s) 171
HpyCH4V TGCA 1 cut(s) 317
HpyF3I CTNAG 2 cut(s) 7, 213
HpySE526I ACGT 1 cut(s) 171
Hsp92II CATG 1 cut(s) 139
Kzo9I GATC 2 cut(s) 13, 132
LmnI GCTCC 1 cut(s) 234
LpnPI CCDG 2 cut(s) 108, 286
MaeI CTAG 2 cut(s) 17, 89
MaeII ACGT 1 cut(s) 171
MaeIII GTNAC 1 cut(s) 208
MalI GATC 2 cut(s) 15, 134
MboI GATC 2 cut(s) 13, 132
MboII GAAGA 3 cut(s) 39, 253, 256
MflI RGATCY 1 cut(s) 13
MlyI GAGTC 1 cut(s) 38
MnlI CCTC 3 cut(s) 170, 199, 209
MseI TTAA 1 cut(s) 60
NdeII GATC 2 cut(s) 13, 132
NlaIII CATG 1 cut(s) 139
NlaIV GGNNCC 2 cut(s) 106, 197
PfeI GAWTC 1 cut(s) 307
PleI GAGTC 1 cut(s) 38
PpsI GAGTC 1 cut(s) 38
PsiI TTATAA 1 cut(s) 168
PspN4I GGNNCC 2 cut(s) 106, 197
PspPI GGNCC 1 cut(s) 152
PsuI RGATCY 1 cut(s) 13
RsaI GTAC 1 cut(s) 83
RsaNI GTAC 1 cut(s) 82
SaqAI TTAA 1 cut(s) 60
Sau3AI GATC 2 cut(s) 13, 132
Sau96I GGNCC 1 cut(s) 152
SchI GAGTC 1 cut(s) 38
SetI ASST 5 cut(s) 106, 162, 174, 201, 210
SinI GGWCC 1 cut(s) 152
SspI AATATT 1 cut(s) 297
SspMI CTAG 2 cut(s) 17, 89
TaaI ACNGT 1 cut(s) 180
TaiI ACGT 1 cut(s) 174
TatI WGTACW 1 cut(s) 81
TfiI GAWTC 1 cut(s) 307
Tru1I TTAA 1 cut(s) 60
Tru9I TTAA 1 cut(s) 60
TspGWI ACGGA 1 cut(s) 70
VpaK11BI GGWCC 1 cut(s) 152
XagI CCTNNNNNAGG 1 cut(s) 203
XbaI TCTAGA 1 cut(s) 16
XmiI GTMKAC 1 cut(s) 182
XspI CTAG 2 cut(s) 17, 89
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.