pycom07g11050

Protein cornichon homolog 4-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr7
OG0002446
Physical Location & Seq
Forward (+)
11458812 .. 11461249
2438 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom07g11050.1

Sequence Viewer

Length: 309 bp
ATGGAGATGCTGTGGACATGGCTGCTGAGTTTCTTCTTCATTCTAGCTTTGTTATGCATTCTGGGTTATCAGCTTGTGTGCTTGGTGGACCTCGAGTATGACTACATCAACCCATATGATTCATCATCTCGGATAAACAATGTCATTTTGCCAGAATTTATTATTCAAGGAGTTTTGTGCTTCATTCTTCTTATAGCGCGACATTGGTTCATGCTTTTCATGGCTCTGCCACACCTATATTATAATGTCAATTTGTATGTGACGAGACGACACTTGGTAGATGTGACTGATCGATCTATAACCAACTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Cornichon

Protein Analysis

103

Amino Acids

12.21

Weight (kDa)

5.35

Isoelectric Point (pI)

45.5

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Cornichon PF03311 5 - 97 3.9e-32 Cornichon protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 243
AccII CGCG 1 cut(s) 199
AcsI RAATTY 1 cut(s) 155
AgsI TTSAA 1 cut(s) 167
AluBI AGCT 2 cut(s) 47, 73
AluI AGCT 2 cut(s) 47, 73
Alw26I GTCTC 1 cut(s) 259
Ama87I CYCGRG 1 cut(s) 92
ApeKI GCWGC 1 cut(s) 22
ApoI RAATTY 1 cut(s) 155
AspLEI GCGC 1 cut(s) 199
AspS9I GGNCC 1 cut(s) 88
AvaI CYCGRG 1 cut(s) 92
AvaII GGWCC 1 cut(s) 88
BbvI GCAGC 1 cut(s) 9
BcoDI GTCTC 1 cut(s) 259
BfaI CTAG 1 cut(s) 44
BisI GCNGC 1 cut(s) 23
BlsI GCNGC 1 cut(s) 24
Bme18I GGWCC 1 cut(s) 88
BmeT110I CYCGRG 1 cut(s) 92
BmgT120I GGNCC 1 cut(s) 88
Bsa29I ATCGAT 1 cut(s) 292
BsaXI ACNNNNNCTCC 1 cut(s) 26
BseCI ATCGAT 1 cut(s) 292
BseMII CTCAG 1 cut(s) 17
BseXI GCAGC 1 cut(s) 9
Bsh1236I CGCG 1 cut(s) 199
BshVI ATCGAT 1 cut(s) 292
BsiHKCI CYCGRG 1 cut(s) 92
BsmAI GTCTC 1 cut(s) 259
BsmBI CGTCTC 1 cut(s) 259
BsmI GAATGC 1 cut(s) 57
BsoBI CYCGRG 1 cut(s) 92
Bsp143I GATC 2 cut(s) 289, 293
BspCNI CTCAG 1 cut(s) 18
BspDI ATCGAT 1 cut(s) 292
BspFNI CGCG 1 cut(s) 199
BssMI GATC 2 cut(s) 289, 293
BstDEI CTNAG 1 cut(s) 26
BstFNI CGCG 1 cut(s) 199
BstHHI GCGC 1 cut(s) 199
BstKTI GATC 2 cut(s) 292, 296
BstMAI GTCTC 1 cut(s) 259
BstMBI GATC 2 cut(s) 289, 293
BstUI CGCG 1 cut(s) 199
BstV1I GCAGC 1 cut(s) 9
Bsu15I ATCGAT 1 cut(s) 292
BsuTUI ATCGAT 1 cut(s) 292
CfoI GCGC 1 cut(s) 199
Cfr13I GGNCC 1 cut(s) 88
ClaI ATCGAT 1 cut(s) 292
CviAII CATG 3 cut(s) 18, 211, 220
CviJI RGCY 4 cut(s) 22, 47, 73, 224
CviKI_1 RGCY 4 cut(s) 22, 47, 73, 224
DdeI CTNAG 1 cut(s) 26
DpnI GATC 2 cut(s) 291, 295
DpnII GATC 2 cut(s) 289, 293
Eco47I GGWCC 1 cut(s) 88
Eco88I CYCGRG 1 cut(s) 92
EcoT22I ATGCAT 1 cut(s) 59
Esp3I CGTCTC 1 cut(s) 259
FaeI CATG 3 cut(s) 21, 214, 223
FatI CATG 3 cut(s) 17, 210, 219
FauNDI CATATG 1 cut(s) 115
Fnu4HI GCNGC 1 cut(s) 23
Fsp4HI GCNGC 1 cut(s) 23
FspBI CTAG 1 cut(s) 44
GlaI GCGC 1 cut(s) 198
GluI GCNGC 1 cut(s) 23
HhaI GCGC 1 cut(s) 199
Hin1II CATG 3 cut(s) 21, 214, 223
Hin6I GCGC 1 cut(s) 197
HinP1I GCGC 1 cut(s) 197
HinfI GANTC 1 cut(s) 119
Hpy166II GTNNAC 2 cut(s) 15, 88
Hpy188I TCNGA 1 cut(s) 132
Hpy8I GTNNAC 2 cut(s) 15, 88
HpyCH4V TGCA 1 cut(s) 57
HpyF3I CTNAG 1 cut(s) 26
Hsp92II CATG 3 cut(s) 21, 214, 223
HspAI GCGC 1 cut(s) 197
Kzo9I GATC 2 cut(s) 289, 293
LpnPI CCDG 2 cut(s) 47, 165
Lsp1109I GCAGC 1 cut(s) 9
MaeI CTAG 1 cut(s) 44
MaeIII GTNAC 2 cut(s) 259, 283
MalI GATC 2 cut(s) 291, 295
MboI GATC 2 cut(s) 289, 293
MboII GAAGA 3 cut(s) 25, 28, 179
MluCI AATT 2 cut(s) 155, 250
MnlI CCTC 1 cut(s) 101
Mph1103I ATGCAT 1 cut(s) 59
Mva1269I GAATGC 1 cut(s) 57
MvnI CGCG 1 cut(s) 199
NdeI CATATG 1 cut(s) 115
NdeII GATC 2 cut(s) 289, 293
NlaIII CATG 3 cut(s) 21, 214, 223
NmuCI GTSAC 2 cut(s) 259, 283
NsiI ATGCAT 1 cut(s) 59
PaeR7I CTCGAG 1 cut(s) 92
PctI GAATGC 1 cut(s) 57
PfeI GAWTC 1 cut(s) 119
PkrI GCNGC 1 cut(s) 24
PsiI TTATAA 1 cut(s) 243
PspPI GGNCC 1 cut(s) 88
PspXI VCTCGAGB 1 cut(s) 92
SatI GCNGC 1 cut(s) 23
Sau3AI GATC 2 cut(s) 289, 293
Sau96I GGNCC 1 cut(s) 88
SetI ASST 4 cut(s) 49, 75, 93, 237
Sfr274I CTCGAG 1 cut(s) 92
SinI GGWCC 1 cut(s) 88
SlaI CTCGAG 1 cut(s) 92
SmlI CTYRAG 1 cut(s) 92
SmoI CTYRAG 1 cut(s) 92
Sse9I AATT 2 cut(s) 155, 250
SspMI CTAG 1 cut(s) 44
TaqI TCGA 2 cut(s) 93, 292
TasI AATT 2 cut(s) 155, 250
TfiI GAWTC 1 cut(s) 119
TseFI GTSAC 2 cut(s) 259, 283
TseI GCWGC 1 cut(s) 22
Tsp45I GTSAC 2 cut(s) 259, 283
TspDTI ATGAA 5 cut(s) 28, 111, 172, 199, 208
VpaK11BI GGWCC 1 cut(s) 88
XapI RAATTY 1 cut(s) 155
XhoI CTCGAG 1 cut(s) 92
XspI CTAG 1 cut(s) 44
Zsp2I ATGCAT 1 cut(s) 59
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.