MD06G1187200.v1.1

Ent-kaurenoic acid oxidase

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr06
OG0004857
Physical Location & Seq
Forward (+)
32459785 .. 32461803
2019 bp
Loading structure...
UTR
Exon/CDS
Intron
MD06G1187200.v1.1.491

Sequence Viewer

Length: 588 bp
ATGAATTTTATATATGTATATATGCATGTGGATGAATTTCTGCAGTGTAGGAAGAAGCTTGAGGCCATTTTCAGGCTGGAGCTGGAGAAGAAGAAGAGCCAAAAACTAGTGACAAATGATCTCATGGATGGGCTTATGCAAATTAAAGATGAGGAAGGTAATAAACTAAGTGACCAAGAGGTGGTAGATAACATCGTCAGCCTTGTTGTAGGTGGATATGCATCTACTTCCATTGCGTCAATGTGTGCTATATATTATTTAGCCAAGCACCCTACTGTCCTAAAAAAGCTTCAGGAGGATAATATGGCTATAAAGAAGAACAAGAAAGGGGATTTTATTACAAGTGAAGATGTTTCAAAAATGAAATACACAAACAAGAAACCAGCTAAGCCCGGAACATATGAAGCTTTTGGTGGTGGAAAAAGAATATGTGCTGGAAACATGCTTGTTAGAATACAACTTGCAATCTTGTTACATCATTTGTCAACAGGATACAAATGGGAATTGGTCAATCCAGATGCAGAGATGAGTTATCTGGCAGATCCAAAACCAGTTGATGGGGTTGATATCACCATTAAAAAGATTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00904 ko01100 ko01110 map00904 map01100 map01110
Pfam Domains
Protein Families
p450

Protein Analysis

196

Amino Acids

22.04

Weight (kDa)

8.77

Isoelectric Point (pI)

26.17

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
p450 PF00067 15 - 126 4.7e-16 Cytochrome P450
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 2 cut(s) 181, 557
AclWI GGATC 1 cut(s) 536
AcsI RAATTY 2 cut(s) 4, 35
AcuI CTGAAG 1 cut(s) 275
AfiI CCNNNNNNNGG 3 cut(s) 72, 181, 557
AgsI TTSAA 1 cut(s) 357
AhlI ACTAGT 1 cut(s) 106
AluBI AGCT 5 cut(s) 58, 82, 289, 386, 407
AluI AGCT 5 cut(s) 58, 82, 289, 386, 407
AlwI GGATC 1 cut(s) 536
AoxI GGCC 1 cut(s) 63
ApoI RAATTY 2 cut(s) 4, 35
AsuC2I CCSGG 1 cut(s) 393
AsuHPI GGTGA 1 cut(s) 562
BccI CCATC 2 cut(s) 122, 551
BciVI GTATCC 1 cut(s) 485
BcnI CCSGG 1 cut(s) 393
BcuI ACTAGT 1 cut(s) 106
BfaI CTAG 1 cut(s) 107
BfmI CTRYAG 1 cut(s) 41
BfuI GTATCC 1 cut(s) 485
BlpI GCTNAGC 1 cut(s) 387
Bme1390I CCNGG 1 cut(s) 393
BmrFI CCNGG 1 cut(s) 393
BmsI GCATC 2 cut(s) 230, 508
BpmI CTGGAG 2 cut(s) 98, 104
Bpu1102I GCTNAGC 1 cut(s) 387
BpuEI CTTGAG 1 cut(s) 80
BpuMI CCSGG 1 cut(s) 393
BsaBI GATNNNNATC 1 cut(s) 220
Bsc4I CCNNNNNNNGG 3 cut(s) 72, 181, 557
Bse1I ACTGG 1 cut(s) 551
Bse3DI GCAATG 1 cut(s) 231
Bse8I GATNNNNATC 1 cut(s) 220
BseGI GGATG 2 cut(s) 37, 133
BseJI GATNNNNATC 1 cut(s) 220
BseLI CCNNNNNNNGG 3 cut(s) 72, 181, 557
BseMI GCAATG 1 cut(s) 231
BseNI ACTGG 1 cut(s) 551
BshFI GGCC 1 cut(s) 65
BsiSI CCGG 1 cut(s) 393
BslI CCNNNNNNNGG 3 cut(s) 72, 181, 557
BsnI GGCC 1 cut(s) 65
Bsp143I GATC 2 cut(s) 118, 541
Bsp1720I GCTNAGC 1 cut(s) 387
BspANI GGCC 1 cut(s) 65
BspMAI CTGCAG 1 cut(s) 45
BspPI GGATC 1 cut(s) 536
BspQI GCTCTTC 1 cut(s) 89
BsrDI GCAATG 1 cut(s) 231
BsrI ACTGG 1 cut(s) 551
BssMI GATC 2 cut(s) 118, 541
Bst4CI ACNGT 1 cut(s) 277
Bst6I CTCTTC 1 cut(s) 89
BstDEI CTNAG 2 cut(s) 167, 387
BstF5I GGATG 2 cut(s) 37, 133
BstKTI GATC 2 cut(s) 121, 544
BstMBI GATC 2 cut(s) 118, 541
BstNSI RCATGY 2 cut(s) 29, 445
BstSCI CCNGG 1 cut(s) 391
BstSFI CTRYAG 1 cut(s) 41
BstX2I RGATCY 1 cut(s) 541
BstYI RGATCY 1 cut(s) 541
BsuI GTATCC 1 cut(s) 485
BsuRI GGCC 1 cut(s) 65
BtsCI GGATG 2 cut(s) 37, 133
BtsI GCAGTG 1 cut(s) 50
BtsIMutI CAGTG 1 cut(s) 50
CseI GACGC 1 cut(s) 225
CviAII CATG 3 cut(s) 26, 124, 442
DdeI CTNAG 2 cut(s) 167, 387
DpnI GATC 2 cut(s) 120, 543
DpnII GATC 2 cut(s) 118, 541
Eam1104I CTCTTC 1 cut(s) 89
EarI CTCTTC 1 cut(s) 89
Eco32I GATATC 1 cut(s) 568
Eco57I CTGAAG 1 cut(s) 275
EcoRV GATATC 1 cut(s) 568
EcoT22I ATGCAT 2 cut(s) 27, 223
FaeI CATG 3 cut(s) 29, 127, 445
FatI CATG 3 cut(s) 25, 123, 441
FauNDI CATATG 1 cut(s) 400
FokI GGATG 2 cut(s) 44, 140
FspBI CTAG 1 cut(s) 107
GsuI CTGGAG 2 cut(s) 98, 104
HaeIII GGCC 1 cut(s) 65
HapII CCGG 1 cut(s) 393
HgaI GACGC 1 cut(s) 225
Hin1II CATG 3 cut(s) 29, 127, 445
HincII GTYRAC 1 cut(s) 486
HindII GTYRAC 1 cut(s) 486
HindIII AAGCTT 3 cut(s) 56, 287, 405
HpaII CCGG 1 cut(s) 393
HphI GGTGA 1 cut(s) 562
Hpy166II GTNNAC 1 cut(s) 486
Hpy188III TCNNGA 2 cut(s) 293, 515
Hpy8I GTNNAC 1 cut(s) 486
HpyAV CCTTC 1 cut(s) 149
HpyCH4III ACNGT 1 cut(s) 277
HpyCH4V TGCA 6 cut(s) 25, 43, 139, 221, 464, 521
HpyF3I CTNAG 2 cut(s) 167, 387
Hsp92II CATG 3 cut(s) 29, 127, 445
Kzo9I GATC 2 cut(s) 118, 541
LguI GCTCTTC 1 cut(s) 89
LmnI GCTCC 1 cut(s) 79
LweI GCATC 2 cut(s) 230, 508
MaeI CTAG 1 cut(s) 107
MaeIII GTNAC 3 cut(s) 109, 170, 471
MalI GATC 2 cut(s) 120, 543
MboI GATC 2 cut(s) 118, 541
MboII GAAGA 6 cut(s) 64, 100, 103, 106, 328, 359
MflI RGATCY 1 cut(s) 541
MluCI AATT 4 cut(s) 4, 35, 141, 503
MnlI CCTC 4 cut(s) 55, 145, 172, 289
Mph1103I ATGCAT 2 cut(s) 27, 223
MseI TTAA 2 cut(s) 144, 576
MslI CAYNNNNRTG 1 cut(s) 30
MspI CCGG 1 cut(s) 393
MspR9I CCNGG 1 cut(s) 393
NciI CCSGG 1 cut(s) 393
NdeI CATATG 1 cut(s) 400
NdeII GATC 2 cut(s) 118, 541
NlaIII CATG 3 cut(s) 29, 127, 445
NmuCI GTSAC 2 cut(s) 109, 170
NsiI ATGCAT 2 cut(s) 27, 223
NspI RCATGY 2 cut(s) 29, 445
PciSI GCTCTTC 1 cut(s) 89
PflMI CCANNNNNTGG 2 cut(s) 181, 557
PstI CTGCAG 1 cut(s) 45
PsuI RGATCY 1 cut(s) 541
RseI CAYNNNNRTG 1 cut(s) 30
SapI GCTCTTC 1 cut(s) 89
SaqAI TTAA 2 cut(s) 144, 576
Sau3AI GATC 2 cut(s) 118, 541
ScrFI CCNGG 1 cut(s) 393
SetI ASST 8 cut(s) 60, 84, 160, 183, 214, 291, 388, 409
SfaNI GCATC 2 cut(s) 230, 508
SfcI CTRYAG 1 cut(s) 41
SmiMI CAYNNNNRTG 1 cut(s) 30
SmlI CTYRAG 1 cut(s) 59
SmoI CTYRAG 1 cut(s) 59
SpeI ACTAGT 1 cut(s) 106
Sse9I AATT 4 cut(s) 4, 35, 141, 503
SspMI CTAG 1 cut(s) 107
StyD4I CCNGG 1 cut(s) 391
TaaI ACNGT 1 cut(s) 277
TasI AATT 4 cut(s) 4, 35, 141, 503
Tru1I TTAA 2 cut(s) 144, 576
Tru9I TTAA 2 cut(s) 144, 576
TscAI CASTG 1 cut(s) 50
TseFI GTSAC 2 cut(s) 109, 170
Tsp45I GTSAC 2 cut(s) 109, 170
TspDTI ATGAA 4 cut(s) 17, 48, 377, 417
TspRI CASTG 1 cut(s) 50
Van91I CCANNNNNTGG 2 cut(s) 181, 557
XapI RAATTY 2 cut(s) 4, 35
XceI RCATGY 2 cut(s) 29, 445
XcmI CCANNNNNNNNNTGG 1 cut(s) 73
XspI CTAG 1 cut(s) 107
Zsp2I ATGCAT 2 cut(s) 27, 223
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.