MD07G1223200.v1.1

Lethal(2) giant larvae protein homolog

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr07
Physical Location & Seq
Reverse (-)
30013058 .. 30015056
1999 bp
Loading structure...
UTR
Exon/CDS
Intron
MD07G1223200.v1.1.491

Sequence Viewer

Length: 177 bp
ATGAAAGATTGGCCATCGTTCAAAAGGTCTTTTCCAAATCTTGAAGAAGTGGGAGAATTTTCATTAATGTCAGTTCTGAGATGGAGCTTCAAGATCAAGGTGGACAAGACAATCTGCTCCTCTGATCATGGACAAATGATTCTGGATTCCGGAGACCTTGCCTTGTCTTCACGATAA

Protein Analysis

59

Amino Acids

6.65

Weight (kDa)

6.53

Isoelectric Point (pI)

54.48

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccIII TCCGGA 1 cut(s) 149
AcoI YGGCCR 1 cut(s) 11
AcsI RAATTY 1 cut(s) 56
AgsI TTSAA 3 cut(s) 22, 44, 91
AluBI AGCT 1 cut(s) 87
AluI AGCT 1 cut(s) 87
Alw26I GTCTC 1 cut(s) 147
Aor13HI TCCGGA 1 cut(s) 149
AoxI GGCC 1 cut(s) 11
ApoI RAATTY 1 cut(s) 56
AseI ATTAAT 1 cut(s) 65
BalI TGGCCA 1 cut(s) 13
BbsI GAAGAC 1 cut(s) 159
BccI CCATC 2 cut(s) 22, 75
BclI TGATCA 1 cut(s) 124
BcoDI GTCTC 1 cut(s) 147
BpiI GAAGAC 1 cut(s) 159
BsaI GGTCTC 1 cut(s) 147
BsaWI WCCGGW 1 cut(s) 149
BseAI TCCGGA 1 cut(s) 149
BseMII CTCAG 1 cut(s) 68
BseRI GAGGAG 1 cut(s) 109
BshFI GGCC 1 cut(s) 13
BsiSI CCGG 1 cut(s) 150
BsmAI GTCTC 1 cut(s) 147
BsnI GGCC 1 cut(s) 13
Bso31I GGTCTC 1 cut(s) 147
Bsp13I TCCGGA 1 cut(s) 149
Bsp143I GATC 2 cut(s) 93, 124
BspANI GGCC 1 cut(s) 13
BspCNI CTCAG 1 cut(s) 69
BspEI TCCGGA 1 cut(s) 149
BspTNI GGTCTC 1 cut(s) 147
BssMI GATC 2 cut(s) 93, 124
BstDEI CTNAG 1 cut(s) 77
BstKTI GATC 2 cut(s) 96, 127
BstMAI GTCTC 1 cut(s) 147
BstMBI GATC 2 cut(s) 93, 124
BstV2I GAAGAC 1 cut(s) 159
BsuRI GGCC 1 cut(s) 13
CviAII CATG 1 cut(s) 128
CviJI RGCY 2 cut(s) 13, 87
CviKI_1 RGCY 2 cut(s) 13, 87
DdeI CTNAG 1 cut(s) 77
DpnI GATC 2 cut(s) 95, 126
DpnII GATC 2 cut(s) 93, 124
EaeI YGGCCR 1 cut(s) 11
Eco31I GGTCTC 1 cut(s) 147
FaeI CATG 1 cut(s) 131
FaiI YATR 1 cut(s) 129
FatI CATG 1 cut(s) 127
FbaI TGATCA 1 cut(s) 124
HaeIII GGCC 1 cut(s) 13
HapII CCGG 1 cut(s) 150
Hin1II CATG 1 cut(s) 131
HinfI GANTC 2 cut(s) 139, 146
HpaII CCGG 1 cut(s) 150
Hpy166II GTNNAC 1 cut(s) 103
Hpy188I TCNGA 2 cut(s) 78, 124
Hpy188III TCNNGA 5 cut(s) 41, 91, 143, 150, 171
Hpy8I GTNNAC 1 cut(s) 103
HpyF3I CTNAG 1 cut(s) 77
Hsp92II CATG 1 cut(s) 131
Kpn2I TCCGGA 1 cut(s) 149
Ksp22I TGATCA 1 cut(s) 124
Kzo9I GATC 2 cut(s) 93, 124
LmnI GCTCC 2 cut(s) 84, 122
LpnPI CCDG 2 cut(s) 128, 163
MalI GATC 2 cut(s) 95, 126
MboI GATC 2 cut(s) 93, 124
MboII GAAGA 2 cut(s) 56, 159
MlsI TGGCCA 1 cut(s) 13
MluCI AATT 1 cut(s) 56
MluNI TGGCCA 1 cut(s) 13
MnlI CCTC 1 cut(s) 130
Mox20I TGGCCA 1 cut(s) 13
MroI TCCGGA 1 cut(s) 149
MscI TGGCCA 1 cut(s) 13
MseI TTAA 1 cut(s) 65
Msp20I TGGCCA 1 cut(s) 13
MspI CCGG 1 cut(s) 150
NdeII GATC 2 cut(s) 93, 124
NlaIII CATG 1 cut(s) 131
PfeI GAWTC 2 cut(s) 139, 146
PshBI ATTAAT 1 cut(s) 65
SaqAI TTAA 1 cut(s) 65
Sau3AI GATC 2 cut(s) 93, 124
SetI ASST 4 cut(s) 29, 89, 102, 159
SgeI CNNG 8 cut(s) 53, 103, 109, 118, 140, 155, 162, 170
Sse9I AATT 1 cut(s) 56
TasI AATT 1 cut(s) 56
TfiI GAWTC 2 cut(s) 139, 146
Tru1I TTAA 1 cut(s) 65
Tru9I TTAA 1 cut(s) 65
TspDTI ATGAA 2 cut(s) 17, 51
VspI ATTAAT 1 cut(s) 65
XapI RAATTY 1 cut(s) 56
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.