Basic Information

Type: gene

Biological Identity

Species

malus_domestica

Chromosome

Chr10

Orthogroup ID

OG0002291

Physical Location & Seq

Genomic Coordinates Forward (+)

10544165 .. 10545038

Gene Structure 874 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

MD10G1074400.v1.1.491

Sequence Viewer

CDS Protein Promoter (2k)

Length: 174 bp

ATGGCTTCAAGCTCCCTTAGAAAACACAACCCCAGCTCTTCATGGACACCAAAGCAGAACAAGCTGTTTGAAAAAGCACTGGCCTTGTACGACAAAGAGACCCCGGAGCGGTGGCAAAATGTGGCTAAAGCTGTAGGTGGCAATAAAACAGCGGAAGAAGTGAAGAAACACTAG

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Myb_DNA-binding

Protein Analysis

58

Amino Acids

6.45

Weight (kDa)

9.82

Isoelectric Point (pI)

64.41

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
Myb_DNA-binding_2	PF23082	14 - 56	1.5e-09	Myb-like DNA-binding domain
Myb_DNA-binding	PF00249	14 - 57	8.6e-07	Myb-like DNA-binding domain

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002291)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G19510 AT1G75250 AT1G75250
fragaria_vesca	FvH4_2g08980 FvH4_2g39660
malus_domestica	MD08G1030400.v1.1 MD10G1074400.v1.1 MD15G1025600.v1.1
prunus_persica	Prupe.1G378000_v2.0.a1 Prupe.8G095800_v2.0.a1
pyrus_communis	pycom10g05830 pycom15g02200
rosa_chinensis	RchiOBHm_Chr3g0458061 RchiOBHm_Chr6g0264661 RchiOBHm_Chr6g0301221
rosa_laevigata	RLG00000014237 RLG00000025176
rosa_multiflora	Rmu_co8206514.1_g000001 Rmu_co8336827.1_g000001 Rmu_sc0000384.1_g000016 Rmu_sc0000546.1_g000016 Rmu_sc0002592.1_g000001
rosa_roxburghii	Rroxscaffold_171G00441330 Rroxscaffold_175G00432000 Rroxscaffold_6G00421310 Rroxscaffold_7G00203220
rosa_rugosa	Rorug03G0024600 Rorug06G0015100 Rorug06G0302500
rosa_samantha	Rh3AG085300 Rh3BG088000 Rh3CG088600 Rh3DG088900 Rh6AG134100 Rh6AG415800 Rh6BG131600 Rh6CG130300 Rh6CG430300 Rh6DG117300
rosa_wichuraiana	Rw0G012440 Rw6G011610 Rw6G036010

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccBSI	CCGCTC	1 cut(s)	109
AciI	CCGC	2 cut(s)	109, 152
AfaI	GTAC	1 cut(s)	89
AfiI	CCNNNNNNNGG	1 cut(s)	108
AgsI	TTSAA	2 cut(s)	9, 71
AluBI	AGCT	4 cut(s)	12, 36, 64, 131
AluI	AGCT	4 cut(s)	12, 36, 64, 131
Alw26I	GTCTC	1 cut(s)	92
AoxI	GGCC	1 cut(s)	81
AsuC2I	CCSGG	1 cut(s)	104
BcnI	CCSGG	1 cut(s)	104
BcoDI	GTCTC	1 cut(s)	92
BfaI	CTAG	1 cut(s)	172
BfmI	CTRYAG	1 cut(s)	132
Bme1390I	CCNGG	1 cut(s)	104
BmrFI	CCNGG	1 cut(s)	104
BpuMI	CCSGG	1 cut(s)	104
BsaI	GGTCTC	1 cut(s)	92
BsaJI	CCNNGG	1 cut(s)	102
Bsc4I	CCNNNNNNNGG	1 cut(s)	108
Bse1I	ACTGG	1 cut(s)	84
BseDI	CCNNGG	1 cut(s)	102
BseLI	CCNNNNNNNGG	1 cut(s)	108
BseNI	ACTGG	1 cut(s)	84
BseYI	CCCAGC	1 cut(s)	32
BshFI	GGCC	1 cut(s)	83
BsiSI	CCGG	1 cut(s)	104
BslI	CCNNNNNNNGG	1 cut(s)	108
BsmAI	GTCTC	1 cut(s)	92
BsnI	GGCC	1 cut(s)	83
Bso31I	GGTCTC	1 cut(s)	92
BspACI	CCGC	2 cut(s)	109, 152
BspANI	GGCC	1 cut(s)	83
BspQI	GCTCTTC	1 cut(s)	43
BspTNI	GGTCTC	1 cut(s)	92
BsrBI	CCGCTC	1 cut(s)	109
BsrI	ACTGG	1 cut(s)	84
BssECI	CCNNGG	1 cut(s)	102
Bst6I	CTCTTC	1 cut(s)	43
BstDEI	CTNAG	1 cut(s)	17
BstMAI	GTCTC	1 cut(s)	92
BstMWI	GCNNNNNNNGC	1 cut(s)	61
BstSCI	CCNGG	1 cut(s)	102
BstSFI	CTRYAG	1 cut(s)	132
BsuRI	GGCC	1 cut(s)	83
BtsIMutI	CAGTG	1 cut(s)	77
Csp6I	GTAC	1 cut(s)	88
CviAII	CATG	1 cut(s)	42
CviJI	RGCY	7 cut(s)	5, 12, 36, 64, 83, 125, 131
CviKI_1	RGCY	7 cut(s)	5, 12, 36, 64, 83, 125, 131
CviQI	GTAC	1 cut(s)	88
DdeI	CTNAG	1 cut(s)	17
Eam1104I	CTCTTC	1 cut(s)	43
EarI	CTCTTC	1 cut(s)	43
Eco31I	GGTCTC	1 cut(s)	92
FaeI	CATG	1 cut(s)	45
FaiI	YATR	1 cut(s)	43
FatI	CATG	1 cut(s)	41
FspBI	CTAG	1 cut(s)	172
GsaI	CCCAGC	1 cut(s)	36
HaeIII	GGCC	1 cut(s)	83
HapII	CCGG	1 cut(s)	104
Hin1II	CATG	1 cut(s)	45
HpaII	CCGG	1 cut(s)	104
HpyF10VI	GCNNNNNNNGC	1 cut(s)	61
HpyF3I	CTNAG	1 cut(s)	17
Hsp92II	CATG	1 cut(s)	45
LguI	GCTCTTC	1 cut(s)	43
LmnI	GCTCC	2 cut(s)	17, 106
LpnPI	CCDG	3 cut(s)	46, 65, 117
MaeI	CTAG	1 cut(s)	172
MbiI	CCGCTC	1 cut(s)	109
MboII	GAAGA	2 cut(s)	30, 167
MspA1I	CMGCKG	1 cut(s)	152
MspI	CCGG	1 cut(s)	104
MspR9I	CCNGG	1 cut(s)	104
MwoI	GCNNNNNNNGC	1 cut(s)	61
NciI	CCSGG	1 cut(s)	104
NlaIII	CATG	1 cut(s)	45
PciSI	GCTCTTC	1 cut(s)	43
PspFI	CCCAGC	1 cut(s)	32
RsaI	GTAC	1 cut(s)	89
RsaNI	GTAC	1 cut(s)	88
SapI	GCTCTTC	1 cut(s)	43
ScrFI	CCNGG	1 cut(s)	104
SetI	ASST	5 cut(s)	14, 38, 66, 133, 139
SfcI	CTRYAG	1 cut(s)	132
SgeI	CNNG	8 cut(s)	21, 45, 54, 73, 92, 97, 115, 116
SsiI	CCGC	2 cut(s)	109, 152
SspMI	CTAG	1 cut(s)	172
StyD4I	CCNGG	1 cut(s)	102
TscAI	CASTG	1 cut(s)	84
TspDTI	ATGAA	1 cut(s)	30
TspRI	CASTG	1 cut(s)	84
XspI	CTAG	1 cut(s)	172

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.