MD14G1180900.v1.1
MYB Family

Transcription factor WER-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr14
OG0005570
Physical Location & Seq
Reverse (-)
27388895 .. 27390062
1168 bp
Loading structure...
UTR
Exon/CDS
Intron
MD14G1180900.v1.1.491

Sequence Viewer

Length: 486 bp
ATGATTATTTCTTGTCTAATTAGGTGGTCTTTGATTGCTGGCCGTGTTCCTGGGAGAACTGACAATCAAGTCAAGAACCATTGGAACAGTCATTTGAGCAAGAAGCTCGGTGTCGGTTCAAAAAGAGGAAAGACAAAAACCAAGACTTATTCCGACTCAAAACGAGCAAAAAATAATTTCTGCATACCCTCATCAGAGTCAAACTCCGAGTTGCAACCACTTCCTAATTCCGATTCCAATTCCAATATTTCTGGTGATCATGAAGCTGCAGCTACCATTGATGGATTTGATGAGGAAATGATGAACATCCAGAACCACATTGGCTCTAAAAGTGAGGTTGGTTTTTGTGGCATGTCGGAGGTGACGATGATGAGTAATGACTACTCATTTTGGTTTCACAATGATGACCTTAATCCATATAGCCCTTATTTATCTGACCCTACTCTGGATGATTACTACCCTTTTCAATTTGATAATTATTTGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Myb_DNA-binding

Protein Analysis

162

Amino Acids

18.19

Weight (kDa)

5.45

Isoelectric Point (pI)

55.47

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Myb_DNA-binding PF00249 8 - 32 2.8e-08 Myb-like DNA-binding domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 68
AcoI YGGCCR 1 cut(s) 40
AfiI CCNNNNNNNGG 1 cut(s) 445
AgsI TTSAA 2 cut(s) 120, 467
AjnI CCWGG 1 cut(s) 49
AluBI AGCT 3 cut(s) 106, 266, 272
AluI AGCT 3 cut(s) 106, 266, 272
AoxI GGCC 1 cut(s) 40
ApeKI GCWGC 2 cut(s) 266, 269
AsuHPI GGTGA 2 cut(s) 266, 373
BbvI GCAGC 2 cut(s) 253, 281
BccI CCATC 1 cut(s) 275
BceAI ACGGC 1 cut(s) 27
BcgI CGANNNNNNTGC 2 cut(s) 88, 122
BciT130I CCWGG 1 cut(s) 51
BclI TGATCA 1 cut(s) 256
BfmI CTRYAG 1 cut(s) 267
BisI GCNGC 2 cut(s) 267, 270
BlsI GCNGC 2 cut(s) 268, 271
Bme1390I CCNGG 1 cut(s) 51
BmrFI CCNGG 1 cut(s) 51
BplI GAGNNNNNCTC 2 cut(s) 188, 220
BsaBI GATNNNNATC 1 cut(s) 305
BsaJI CCNNGG 1 cut(s) 50
Bsc4I CCNNNNNNNGG 1 cut(s) 445
Bse8I GATNNNNATC 1 cut(s) 305
BseBI CCWGG 1 cut(s) 51
BseDI CCNNGG 1 cut(s) 50
BseGI GGATG 2 cut(s) 306, 454
BseJI GATNNNNATC 1 cut(s) 305
BseLI CCNNNNNNNGG 1 cut(s) 445
BseXI GCAGC 2 cut(s) 253, 281
BshFI GGCC 1 cut(s) 42
BslI CCNNNNNNNGG 1 cut(s) 445
BsnI GGCC 1 cut(s) 42
Bsp143I GATC 1 cut(s) 256
BspANI GGCC 1 cut(s) 42
BspHI TCATGA 1 cut(s) 259
BspMAI CTGCAG 1 cut(s) 271
BssECI CCNNGG 1 cut(s) 50
BssMI GATC 1 cut(s) 256
Bst2UI CCWGG 1 cut(s) 51
Bst4CI ACNGT 1 cut(s) 89
BstC8I GCNNGC 1 cut(s) 40
BstF5I GGATG 2 cut(s) 306, 454
BstKTI GATC 1 cut(s) 259
BstMBI GATC 1 cut(s) 256
BstNI CCWGG 1 cut(s) 51
BstNSI RCATGY 1 cut(s) 355
BstSCI CCNGG 1 cut(s) 49
BstSFI CTRYAG 1 cut(s) 267
BstV1I GCAGC 2 cut(s) 253, 281
BsuRI GGCC 1 cut(s) 42
BtsCI GGATG 2 cut(s) 306, 454
Cac8I GCNNGC 1 cut(s) 40
CciI TCATGA 1 cut(s) 259
CviAII CATG 2 cut(s) 260, 352
CviJI RGCY 6 cut(s) 42, 106, 266, 272, 324, 423
CviKI_1 RGCY 6 cut(s) 42, 106, 266, 272, 324, 423
DpnI GATC 1 cut(s) 258
DpnII GATC 1 cut(s) 256
DrdI GACNNNNNNGTC 1 cut(s) 68
DseDI GACNNNNNNGTC 1 cut(s) 68
EaeI YGGCCR 1 cut(s) 40
EcoRII CCWGG 1 cut(s) 49
FaeI CATG 2 cut(s) 263, 355
FaiI YATR 5 cut(s) 185, 261, 353, 418, 420
FatI CATG 2 cut(s) 259, 351
FbaI TGATCA 1 cut(s) 256
Fnu4HI GCNGC 2 cut(s) 267, 270
FokI GGATG 2 cut(s) 293, 461
Fsp4HI GCNGC 2 cut(s) 267, 270
GluI GCNGC 2 cut(s) 267, 270
HaeIII GGCC 1 cut(s) 42
Hin1II CATG 2 cut(s) 263, 355
HinfI GANTC 3 cut(s) 155, 197, 233
HphI GGTGA 2 cut(s) 266, 373
Hpy188I TCNGA 6 cut(s) 154, 196, 208, 232, 358, 436
Hpy188III TCNNGA 4 cut(s) 73, 260, 310, 446
HpyCH4III ACNGT 1 cut(s) 89
HpyCH4V TGCA 3 cut(s) 183, 214, 269
Hsp92II CATG 2 cut(s) 263, 355
Ksp22I TGATCA 1 cut(s) 256
Kzo9I GATC 1 cut(s) 256
LpnPI CCDG 6 cut(s) 24, 36, 63, 237, 323, 431
Lsp1109I GCAGC 2 cut(s) 253, 281
MaeIII GTNAC 1 cut(s) 361
MalI GATC 1 cut(s) 258
MboI GATC 1 cut(s) 256
MluCI AATT 6 cut(s) 18, 175, 226, 238, 467, 475
MlyI GAGTC 2 cut(s) 149, 206
MmeI TCCRAC 2 cut(s) 177, 336
MnlI CCTC 5 cut(s) 119, 199, 286, 328, 352
MseI TTAA 1 cut(s) 411
MslI CAYNNNNRTG 1 cut(s) 402
MspR9I CCNGG 1 cut(s) 51
MvaI CCWGG 1 cut(s) 51
NdeII GATC 1 cut(s) 256
NlaIII CATG 2 cut(s) 263, 355
NmuCI GTSAC 1 cut(s) 361
NspI RCATGY 1 cut(s) 355
PagI TCATGA 1 cut(s) 259
PcsI WCGNNNNNNNCGW 1 cut(s) 362
PfeI GAWTC 1 cut(s) 233
PkrI GCNGC 2 cut(s) 268, 271
PleI GAGTC 2 cut(s) 149, 205
PpsI GAGTC 2 cut(s) 149, 205
Psp6I CCWGG 1 cut(s) 49
PspGI CCWGG 1 cut(s) 49
PstI CTGCAG 1 cut(s) 271
RseI CAYNNNNRTG 1 cut(s) 402
SaqAI TTAA 1 cut(s) 411
SatI GCNGC 2 cut(s) 267, 270
Sau3AI GATC 1 cut(s) 256
SchI GAGTC 2 cut(s) 149, 206
ScrFI CCNGG 1 cut(s) 51
SetI ASST 7 cut(s) 26, 108, 268, 274, 339, 363, 411
SfcI CTRYAG 1 cut(s) 267
SmiMI CAYNNNNRTG 1 cut(s) 402
Sse9I AATT 6 cut(s) 18, 175, 226, 238, 467, 475
SspI AATATT 1 cut(s) 247
StyD4I CCNGG 1 cut(s) 49
TaaI ACNGT 1 cut(s) 89
TasI AATT 6 cut(s) 18, 175, 226, 238, 467, 475
TfiI GAWTC 1 cut(s) 233
Tru1I TTAA 1 cut(s) 411
Tru9I TTAA 1 cut(s) 411
TseFI GTSAC 1 cut(s) 361
TseI GCWGC 2 cut(s) 266, 269
Tsp45I GTSAC 1 cut(s) 361
TspDTI ATGAA 2 cut(s) 276, 317
XceI RCATGY 1 cut(s) 355
XcmI CCANNNNNNNNNTGG 1 cut(s) 317
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.