Prupe.2G034700_v2.0.a1

two-component response regulator

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp02
Physical Location & Seq
Reverse (-)
3741026 .. 3742992
1967 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.2G034700.1

Sequence Viewer

Length: 558 bp
ATGGGTTTGTCTGCAGAGGCCCAATTTCATGTTCTGGCTGTTGATGATAGCGTTATTGATAGAAAGTTGATTGAGAGACTTCTCAAGACTTCTTCATACCAAGTTACTGCTGTTGATTCTGGAAGTAAGGCTTTGGAATTTTTGGGTTTGCATGATCAAGATGATCAAATTGATGCAGATATTCCCTCTCTGTCCCCAGATAATCATCAACAGGATGTAGAAGTAAATTTGATCATTACAGATTACTGTATGCCAGGAATGACAGGCTATGATCTTCTCAGAAAGATTAAGGAATCTCATGTTCTTAAAGACATACCAGTTGTTATTATGTCCTCAGAGAATGAGCCATCAAGGATCAACAGATGCTTGGAGGAAGGAGCAGAAGAGTTCTTTCTAAAACCAGTGCAATTGTCAGATGTGAACAAGCTTAAACCCCACATGTTGAAGGGTAGGGCTATGGAAGACCAATCCAACAACAACAAGAGAAAGGTCATGGAACAAACACAAACACCAGAGAGAACAAGAACAAAGTATAATGATTTGGAAGTGACTTCATGA

Protein Analysis

186

Amino Acids

20.97

Weight (kDa)

4.96

Isoelectric Point (pI)

40.68

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 362
AcsI RAATTY 2 cut(s) 137, 226
AflIII ACRYGT 1 cut(s) 438
AgsI TTSAA 1 cut(s) 445
AjnI CCWGG 1 cut(s) 253
AjuI GAANNNNNNNTTGG 2 cut(s) 15, 47
AluBI AGCT 1 cut(s) 427
AluI AGCT 1 cut(s) 427
Alw26I GTCTC 1 cut(s) 70
AlwI GGATC 1 cut(s) 362
AoxI GGCC 1 cut(s) 18
ApoI RAATTY 2 cut(s) 137, 226
AspS9I GGNCC 1 cut(s) 19
BbsI GAAGAC 1 cut(s) 468
BccI CCATC 1 cut(s) 355
BciT130I CCWGG 1 cut(s) 255
BclI TGATCA 3 cut(s) 154, 163, 231
BcoDI GTCTC 1 cut(s) 70
BfmI CTRYAG 1 cut(s) 12
Bme1390I CCNGG 1 cut(s) 255
BmgT120I GGNCC 1 cut(s) 19
BmrFI CCNGG 1 cut(s) 255
BmsI GCATC 2 cut(s) 163, 353
BpiI GAAGAC 1 cut(s) 468
BpuEI CTTGAG 1 cut(s) 68
BsaBI GATNNNNATC 1 cut(s) 204
Bse1I ACTGG 2 cut(s) 317, 401
Bse8I GATNNNNATC 1 cut(s) 204
BseBI CCWGG 1 cut(s) 255
BseGI GGATG 1 cut(s) 220
BseJI GATNNNNATC 1 cut(s) 204
BseMII CTCAG 2 cut(s) 292, 348
BseNI ACTGG 2 cut(s) 317, 401
BshFI GGCC 1 cut(s) 20
BslFI GGGAC 1 cut(s) 178
BsmAI GTCTC 1 cut(s) 70
BsmFI GGGAC 1 cut(s) 178
BsnI GGCC 1 cut(s) 20
Bsp143I GATC 5 cut(s) 154, 163, 231, 271, 354
BspANI GGCC 1 cut(s) 20
BspCNI CTCAG 2 cut(s) 291, 347
BspHI TCATGA 1 cut(s) 554
BspMAI CTGCAG 1 cut(s) 16
BspPI GGATC 1 cut(s) 362
BsrI ACTGG 2 cut(s) 317, 401
BssMI GATC 5 cut(s) 154, 163, 231, 271, 354
Bst2UI CCWGG 1 cut(s) 255
Bst4CI ACNGT 1 cut(s) 248
Bst6I CTCTTC 1 cut(s) 378
BstDEI CTNAG 2 cut(s) 278, 334
BstF5I GGATG 1 cut(s) 220
BstKTI GATC 5 cut(s) 157, 166, 234, 274, 357
BstMAI GTCTC 1 cut(s) 70
BstMBI GATC 5 cut(s) 154, 163, 231, 271, 354
BstNI CCWGG 1 cut(s) 255
BstNSI RCATGY 1 cut(s) 442
BstSCI CCNGG 1 cut(s) 253
BstSFI CTRYAG 1 cut(s) 12
BstV2I GAAGAC 1 cut(s) 468
BsuRI GGCC 1 cut(s) 20
BtsCI GGATG 1 cut(s) 220
BtsIMutI CAGTG 1 cut(s) 408
CciI TCATGA 1 cut(s) 554
Cfr13I GGNCC 1 cut(s) 19
CviAII CATG 6 cut(s) 29, 152, 299, 439, 493, 555
CviJI RGCY 7 cut(s) 20, 38, 131, 267, 346, 427, 455
CviKI_1 RGCY 7 cut(s) 20, 38, 131, 267, 346, 427, 455
DdeI CTNAG 2 cut(s) 278, 334
DpnI GATC 5 cut(s) 156, 165, 233, 273, 356
DpnII GATC 5 cut(s) 154, 163, 231, 271, 354
Eam1104I CTCTTC 1 cut(s) 378
EarI CTCTTC 1 cut(s) 378
EcoRII CCWGG 1 cut(s) 253
FaeI CATG 6 cut(s) 32, 155, 302, 442, 496, 558
FalI AAGNNNNNCTT 2 cut(s) 115, 147
FaqI GGGAC 1 cut(s) 178
FatI CATG 6 cut(s) 28, 151, 298, 438, 492, 554
FbaI TGATCA 3 cut(s) 154, 163, 231
FokI GGATG 1 cut(s) 227
HaeIII GGCC 1 cut(s) 20
Hin1II CATG 6 cut(s) 32, 155, 302, 442, 496, 558
HindIII AAGCTT 1 cut(s) 425
HinfI GANTC 2 cut(s) 116, 293
Hpy166II GTNNAC 1 cut(s) 421
Hpy188I TCNGA 3 cut(s) 281, 337, 415
Hpy188III TCNNGA 4 cut(s) 85, 120, 158, 555
Hpy8I GTNNAC 1 cut(s) 421
HpyAV CCTTC 2 cut(s) 368, 439
HpyCH4III ACNGT 1 cut(s) 248
HpyCH4V TGCA 4 cut(s) 14, 151, 176, 406
HpyF3I CTNAG 2 cut(s) 278, 334
Hsp92II CATG 6 cut(s) 32, 155, 302, 442, 496, 558
Ksp22I TGATCA 3 cut(s) 154, 163, 231
Kzo9I GATC 5 cut(s) 154, 163, 231, 271, 354
LmnI GCTCC 1 cut(s) 377
LweI GCATC 2 cut(s) 163, 353
MaeIII GTNAC 2 cut(s) 103, 547
MalI GATC 5 cut(s) 156, 165, 233, 273, 356
MboI GATC 5 cut(s) 154, 163, 231, 271, 354
MboII GAAGA 4 cut(s) 84, 266, 395, 473
MfeI CAATTG 1 cut(s) 407
MluCI AATT 5 cut(s) 23, 137, 168, 226, 407
MmeI TCCRAC 1 cut(s) 495
MnlI CCTC 4 cut(s) 10, 196, 343, 364
MseI TTAA 3 cut(s) 288, 306, 429
MspR9I CCNGG 1 cut(s) 255
MunI CAATTG 1 cut(s) 407
MvaI CCWGG 1 cut(s) 255
NdeII GATC 5 cut(s) 154, 163, 231, 271, 354
NlaIII CATG 6 cut(s) 32, 155, 302, 442, 496, 558
NmuCI GTSAC 1 cut(s) 547
NspI RCATGY 1 cut(s) 442
PagI TCATGA 1 cut(s) 554
PciI ACATGT 1 cut(s) 438
PfeI GAWTC 2 cut(s) 116, 293
PscI ACATGT 1 cut(s) 438
Psp6I CCWGG 1 cut(s) 253
PspGI CCWGG 1 cut(s) 253
PspPI GGNCC 1 cut(s) 19
PstI CTGCAG 1 cut(s) 16
SaqAI TTAA 3 cut(s) 288, 306, 429
Sau3AI GATC 5 cut(s) 154, 163, 231, 271, 354
Sau96I GGNCC 1 cut(s) 19
ScrFI CCNGG 1 cut(s) 255
SetI ASST 2 cut(s) 429, 492
SfaNI GCATC 2 cut(s) 163, 353
SfcI CTRYAG 1 cut(s) 12
SmlI CTYRAG 1 cut(s) 83
SmoI CTYRAG 1 cut(s) 83
Sse9I AATT 5 cut(s) 23, 137, 168, 226, 407
StyD4I CCNGG 1 cut(s) 253
TaaI ACNGT 1 cut(s) 248
TasI AATT 5 cut(s) 23, 137, 168, 226, 407
TfiI GAWTC 2 cut(s) 116, 293
Tru1I TTAA 3 cut(s) 288, 306, 429
Tru9I TTAA 3 cut(s) 288, 306, 429
TscAI CASTG 1 cut(s) 408
TseFI GTSAC 1 cut(s) 547
Tsp45I GTSAC 1 cut(s) 547
TspDTI ATGAA 3 cut(s) 17, 84, 543
TspRI CASTG 1 cut(s) 408
XapI RAATTY 2 cut(s) 137, 226
XceI RCATGY 1 cut(s) 442
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.