Rmu_sc0002529.1_g000022

two-component response regulator

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002529.1
Physical Location & Seq
Forward (+)
82505 .. 83711
1207 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002529.1_g000022.1.cds

Sequence Viewer

Length: 564 bp
atgggtgtgggagctgcagaggcccagtttcatgttctggctgttgatgatagcatcattgacagaaagttgattgagagacttctcaagacttcttcttatcaagttactgctgtagattctggtattaaggctttagaatttttgggtttgaatgatgaagacgatcacagtgatattgcagaagctccttctgtgtctccaaacaatcatcatcaggatgtagatgtgaatttgatcattacagattactgcatgccaggaatgacaggctatgatctcctcagaaagattaaggaatccaagtctcttaaagacataccagttgttatcatgtcctcagagaatgaaccatcaaggatcaacagatgcttagaggaaggagcagaggagttctttctgaaaccagtaaaattgtcagatgtcaacaagcttagaccccatatgatgaagggtacaagtatagaagacgaaggcaacatcaacgagggaaaggccatggaagaaatccaaacacctgagagaactagaacaatatataatggctttgatgtgctttcatga

Protein Analysis

187

Amino Acids

20.85

Weight (kDa)

4.71

Isoelectric Point (pI)

42.24

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 368
AcsI RAATTY 2 cut(s) 140, 232
AfaI GTAC 1 cut(s) 457
AgsI TTSAA 1 cut(s) 154
AjnI CCWGG 1 cut(s) 259
AluBI AGCT 3 cut(s) 14, 188, 433
AluI AGCT 3 cut(s) 14, 188, 433
Alw26I GTCTC 3 cut(s) 73, 204, 312
AlwI GGATC 1 cut(s) 368
AoxI GGCC 2 cut(s) 21, 495
ApeKI GCWGC 1 cut(s) 14
ApoI RAATTY 2 cut(s) 140, 232
AspS9I GGNCC 1 cut(s) 22
BbsI GAAGAC 2 cut(s) 168, 474
BccI CCATC 1 cut(s) 361
BciT130I CCWGG 1 cut(s) 261
BclI TGATCA 1 cut(s) 237
BcoDI GTCTC 3 cut(s) 73, 204, 312
BfaI CTAG 1 cut(s) 528
BfmI CTRYAG 2 cut(s) 15, 114
BisI GCNGC 1 cut(s) 15
BlsI GCNGC 1 cut(s) 16
Bme1390I CCNGG 1 cut(s) 261
BmgT120I GGNCC 1 cut(s) 22
BmrFI CCNGG 1 cut(s) 261
BmrI ACTGGG 1 cut(s) 19
BmsI GCATC 2 cut(s) 63, 359
BmuI ACTGGG 1 cut(s) 19
BpiI GAAGAC 2 cut(s) 168, 474
BpuEI CTTGAG 1 cut(s) 71
BsaJI CCNNGG 1 cut(s) 498
Bse1I ACTGG 3 cut(s) 25, 323, 407
BseBI CCWGG 1 cut(s) 261
BseDI CCNNGG 1 cut(s) 498
BseGI GGATG 1 cut(s) 226
BseMII CTCAG 3 cut(s) 298, 354, 510
BseNI ACTGG 3 cut(s) 25, 323, 407
BseRI GAGGAG 2 cut(s) 272, 404
BshFI GGCC 2 cut(s) 23, 497
BsmAI GTCTC 3 cut(s) 73, 204, 312
BsnI GGCC 2 cut(s) 23, 497
Bsp143I GATC 4 cut(s) 166, 237, 277, 360
Bsp19I CCATGG 1 cut(s) 498
BspANI GGCC 2 cut(s) 23, 497
BspCNI CTCAG 3 cut(s) 297, 353, 511
BspHI TCATGA 1 cut(s) 560
BspMAI CTGCAG 1 cut(s) 19
BspPI GGATC 1 cut(s) 368
BsrI ACTGG 3 cut(s) 25, 323, 407
BssECI CCNNGG 1 cut(s) 498
BssMI GATC 4 cut(s) 166, 237, 277, 360
BssT1I CCWWGG 1 cut(s) 498
Bst2UI CCWGG 1 cut(s) 261
Bst4CI ACNGT 1 cut(s) 173
BstC8I GCNNGC 1 cut(s) 257
BstDEI CTNAG 5 cut(s) 284, 340, 373, 434, 519
BstDSI CCRYGG 1 cut(s) 498
BstF5I GGATG 1 cut(s) 226
BstKTI GATC 4 cut(s) 169, 240, 280, 363
BstMAI GTCTC 3 cut(s) 73, 204, 312
BstMBI GATC 4 cut(s) 166, 237, 277, 360
BstMWI GCNNNNNNNGC 1 cut(s) 20
BstNI CCWGG 1 cut(s) 261
BstNSI RCATGY 1 cut(s) 259
BstSCI CCNGG 1 cut(s) 259
BstSFI CTRYAG 2 cut(s) 15, 114
BstV2I GAAGAC 2 cut(s) 168, 474
BsuRI GGCC 2 cut(s) 23, 497
BtgI CCRYGG 1 cut(s) 498
BtsCI GGATG 1 cut(s) 226
BtsIMutI CAGTG 1 cut(s) 178
Cac8I GCNNGC 1 cut(s) 257
CciI TCATGA 1 cut(s) 560
Cfr13I GGNCC 1 cut(s) 22
Csp6I GTAC 1 cut(s) 456
CviAII CATG 5 cut(s) 32, 256, 334, 499, 561
CviJI RGCY 9 cut(s) 14, 23, 41, 134, 188, 273, 433, 497, 546
CviKI_1 RGCY 9 cut(s) 14, 23, 41, 134, 188, 273, 433, 497, 546
CviQI GTAC 1 cut(s) 456
DdeI CTNAG 5 cut(s) 284, 340, 373, 434, 519
DpnI GATC 4 cut(s) 168, 239, 279, 362
DpnII GATC 4 cut(s) 166, 237, 277, 360
Eco130I CCWWGG 1 cut(s) 498
EcoRII CCWGG 1 cut(s) 259
EcoT14I CCWWGG 1 cut(s) 498
ErhI CCWWGG 1 cut(s) 498
FaeI CATG 5 cut(s) 35, 259, 337, 502, 564
FatI CATG 5 cut(s) 31, 255, 333, 498, 560
FauNDI CATATG 1 cut(s) 444
FbaI TGATCA 1 cut(s) 237
Fnu4HI GCNGC 1 cut(s) 15
FokI GGATG 1 cut(s) 233
Fsp4HI GCNGC 1 cut(s) 15
FspBI CTAG 1 cut(s) 528
GluI GCNGC 1 cut(s) 15
HaeIII GGCC 2 cut(s) 23, 497
Hin1II CATG 5 cut(s) 35, 259, 337, 502, 564
HincII GTYRAC 1 cut(s) 427
HindII GTYRAC 1 cut(s) 427
HindIII AAGCTT 1 cut(s) 431
HinfI GANTC 2 cut(s) 119, 299
Hpy166II GTNNAC 1 cut(s) 427
Hpy188I TCNGA 4 cut(s) 287, 343, 402, 421
Hpy188III TCNNGA 3 cut(s) 88, 218, 561
Hpy8I GTNNAC 1 cut(s) 427
HpyAV CCTTC 4 cut(s) 201, 374, 445, 467
HpyCH4III ACNGT 1 cut(s) 173
HpyCH4V TGCA 3 cut(s) 17, 182, 255
HpyF10VI GCNNNNNNNGC 1 cut(s) 20
HpyF3I CTNAG 5 cut(s) 284, 340, 373, 434, 519
Hsp92II CATG 5 cut(s) 35, 259, 337, 502, 564
Ksp22I TGATCA 1 cut(s) 237
Kzo9I GATC 4 cut(s) 166, 237, 277, 360
LmnI GCTCC 3 cut(s) 11, 193, 383
LweI GCATC 2 cut(s) 63, 359
MaeI CTAG 1 cut(s) 528
MaeIII GTNAC 1 cut(s) 106
MalI GATC 4 cut(s) 168, 239, 279, 362
MboI GATC 4 cut(s) 166, 237, 277, 360
MboII GAAGA 4 cut(s) 87, 173, 479, 515
MluCI AATT 3 cut(s) 140, 232, 413
MnlI CCTC 6 cut(s) 13, 293, 349, 370, 382, 481
MseI TTAA 3 cut(s) 129, 294, 312
MslI CAYNNNNRTG 1 cut(s) 219
MspR9I CCNGG 1 cut(s) 261
MvaI CCWGG 1 cut(s) 261
MwoI GCNNNNNNNGC 1 cut(s) 20
NcoI CCATGG 1 cut(s) 498
NdeI CATATG 1 cut(s) 444
NdeII GATC 4 cut(s) 166, 237, 277, 360
NlaIII CATG 5 cut(s) 35, 259, 337, 502, 564
NspI RCATGY 1 cut(s) 259
PaeI GCATGC 1 cut(s) 259
PagI TCATGA 1 cut(s) 560
PfeI GAWTC 2 cut(s) 119, 299
PkrI GCNGC 1 cut(s) 16
Psp6I CCWGG 1 cut(s) 259
PspGI CCWGG 1 cut(s) 259
PspPI GGNCC 1 cut(s) 22
PstI CTGCAG 1 cut(s) 19
RsaI GTAC 1 cut(s) 457
RsaNI GTAC 1 cut(s) 456
RseI CAYNNNNRTG 1 cut(s) 219
SaqAI TTAA 3 cut(s) 129, 294, 312
SatI GCNGC 1 cut(s) 15
Sau3AI GATC 4 cut(s) 166, 237, 277, 360
Sau96I GGNCC 1 cut(s) 22
ScrFI CCNGG 1 cut(s) 261
SetI ASST 4 cut(s) 16, 190, 435, 520
SfaNI GCATC 2 cut(s) 63, 359
SfcI CTRYAG 2 cut(s) 15, 114
SmiMI CAYNNNNRTG 1 cut(s) 219
SmlI CTYRAG 1 cut(s) 86
SmoI CTYRAG 1 cut(s) 86
SphI GCATGC 1 cut(s) 259
Sse9I AATT 3 cut(s) 140, 232, 413
SspMI CTAG 1 cut(s) 528
StyD4I CCNGG 1 cut(s) 259
StyI CCWWGG 1 cut(s) 498
TaaI ACNGT 1 cut(s) 173
TasI AATT 3 cut(s) 140, 232, 413
TfiI GAWTC 2 cut(s) 119, 299
Tru1I TTAA 3 cut(s) 129, 294, 312
Tru9I TTAA 3 cut(s) 129, 294, 312
TscAI CASTG 1 cut(s) 178
TseI GCWGC 1 cut(s) 14
TspDTI ATGAA 5 cut(s) 20, 174, 363, 464, 549
TspRI CASTG 1 cut(s) 178
XapI RAATTY 2 cut(s) 140, 232
XceI RCATGY 1 cut(s) 259
XspI CTAG 1 cut(s) 528
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.