Rw1G004980

two-component response regulator

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr1
Physical Location & Seq
Forward (+)
9515375 .. 9517413
2039 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw1G004980.1

Sequence Viewer

Length: 549 bp
ATGAGAGGCCAGTTTCATGTTCTGGCTGTTGATGATAGCATCATTGACAGAAAGTTGATTGAGAGACTTCTCAAGACTTCTTCTTATCAAGTTACTGCTGTAGATTCTGGTATTAAGGCTTTAGAATTTTTGGGTTTGAATGATGAAGACGATCAAAGTGATATTGCAGAAGCTCCTTCTGTGTCTCCAAACAATCATCATCAGGATGTAGATGTGAATTTGATCATTACAGATTACTGCATGCCAGGAATGACAGGCTACGATCTCCTCAGAAAGATTAAGGAATCCAAGTCTCTTAAAGACATACCAGTTGTTATCATGTCCTCAGAGAATGAACCATCAAGGATCAACAGATGCTTAGAGGAAGGAGCAGAGGAGTTCTTTCTGAAACCAGTAAAATTGTCAGATGTCAACAAGCTTAGACCCCATATGATGAAGGGTACAAGTATAGAAGACGAAGGCAACATCAACGAGGGAAAGGCCATGGAAGAAATCCAAACACCTGAGAGAACTAGAACAATATATAATGGCTTTGATGTGCTTTCATGA

Protein Analysis

182

Amino Acids

20.5

Weight (kDa)

4.76

Isoelectric Point (pI)

45.6

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Response_reg PF00072 7 - 137 6.6e-18 Response regulator receiver domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 353
AcsI RAATTY 2 cut(s) 125, 217
AfaI GTAC 1 cut(s) 442
AgsI TTSAA 1 cut(s) 139
AjnI CCWGG 1 cut(s) 244
AluBI AGCT 2 cut(s) 173, 418
AluI AGCT 2 cut(s) 173, 418
Alw26I GTCTC 3 cut(s) 58, 189, 297
AlwI GGATC 1 cut(s) 353
AoxI GGCC 2 cut(s) 7, 480
ApoI RAATTY 2 cut(s) 125, 217
BbsI GAAGAC 2 cut(s) 153, 459
BccI CCATC 1 cut(s) 346
BciT130I CCWGG 1 cut(s) 246
BclI TGATCA 1 cut(s) 222
BcoDI GTCTC 3 cut(s) 58, 189, 297
BfaI CTAG 1 cut(s) 513
BfmI CTRYAG 1 cut(s) 99
Bme1390I CCNGG 1 cut(s) 246
BmrFI CCNGG 1 cut(s) 246
BmsI GCATC 2 cut(s) 48, 344
BpiI GAAGAC 2 cut(s) 153, 459
BpuEI CTTGAG 1 cut(s) 56
BsaJI CCNNGG 1 cut(s) 483
Bse1I ACTGG 3 cut(s) 10, 308, 392
BseBI CCWGG 1 cut(s) 246
BseDI CCNNGG 1 cut(s) 483
BseGI GGATG 1 cut(s) 211
BseMII CTCAG 3 cut(s) 283, 339, 495
BseNI ACTGG 3 cut(s) 10, 308, 392
BseRI GAGGAG 2 cut(s) 257, 389
BshFI GGCC 2 cut(s) 9, 482
BsmAI GTCTC 3 cut(s) 58, 189, 297
BsnI GGCC 2 cut(s) 9, 482
Bsp143I GATC 4 cut(s) 151, 222, 262, 345
Bsp19I CCATGG 1 cut(s) 483
BspANI GGCC 2 cut(s) 9, 482
BspCNI CTCAG 3 cut(s) 282, 338, 496
BspHI TCATGA 1 cut(s) 545
BspPI GGATC 1 cut(s) 353
BsrI ACTGG 3 cut(s) 10, 308, 392
BssECI CCNNGG 1 cut(s) 483
BssMI GATC 4 cut(s) 151, 222, 262, 345
BssT1I CCWWGG 1 cut(s) 483
Bst2UI CCWGG 1 cut(s) 246
BstC8I GCNNGC 1 cut(s) 242
BstDEI CTNAG 5 cut(s) 269, 325, 358, 419, 504
BstDSI CCRYGG 1 cut(s) 483
BstF5I GGATG 1 cut(s) 211
BstKTI GATC 4 cut(s) 154, 225, 265, 348
BstMAI GTCTC 3 cut(s) 58, 189, 297
BstMBI GATC 4 cut(s) 151, 222, 262, 345
BstNI CCWGG 1 cut(s) 246
BstNSI RCATGY 1 cut(s) 244
BstSCI CCNGG 1 cut(s) 244
BstSFI CTRYAG 1 cut(s) 99
BstV2I GAAGAC 2 cut(s) 153, 459
BsuRI GGCC 2 cut(s) 9, 482
BtgI CCRYGG 1 cut(s) 483
BtsCI GGATG 1 cut(s) 211
Cac8I GCNNGC 1 cut(s) 242
CciI TCATGA 1 cut(s) 545
Csp6I GTAC 1 cut(s) 441
CviAII CATG 5 cut(s) 17, 241, 319, 484, 546
CviJI RGCY 8 cut(s) 9, 26, 119, 173, 258, 418, 482, 531
CviKI_1 RGCY 8 cut(s) 9, 26, 119, 173, 258, 418, 482, 531
CviQI GTAC 1 cut(s) 441
DdeI CTNAG 5 cut(s) 269, 325, 358, 419, 504
DpnI GATC 4 cut(s) 153, 224, 264, 347
DpnII GATC 4 cut(s) 151, 222, 262, 345
Eco130I CCWWGG 1 cut(s) 483
EcoRII CCWGG 1 cut(s) 244
EcoT14I CCWWGG 1 cut(s) 483
ErhI CCWWGG 1 cut(s) 483
FaeI CATG 5 cut(s) 20, 244, 322, 487, 549
FatI CATG 5 cut(s) 16, 240, 318, 483, 545
FauNDI CATATG 1 cut(s) 429
FbaI TGATCA 1 cut(s) 222
FokI GGATG 1 cut(s) 218
FspBI CTAG 1 cut(s) 513
HaeIII GGCC 2 cut(s) 9, 482
Hin1II CATG 5 cut(s) 20, 244, 322, 487, 549
HincII GTYRAC 1 cut(s) 412
HindII GTYRAC 1 cut(s) 412
HindIII AAGCTT 1 cut(s) 416
HinfI GANTC 2 cut(s) 104, 284
Hpy166II GTNNAC 1 cut(s) 412
Hpy188I TCNGA 4 cut(s) 272, 328, 387, 406
Hpy188III TCNNGA 3 cut(s) 73, 203, 546
Hpy8I GTNNAC 1 cut(s) 412
HpyAV CCTTC 4 cut(s) 186, 359, 430, 452
HpyCH4V TGCA 2 cut(s) 167, 240
HpyF3I CTNAG 5 cut(s) 269, 325, 358, 419, 504
Hsp92II CATG 5 cut(s) 20, 244, 322, 487, 549
Ksp22I TGATCA 1 cut(s) 222
Kzo9I GATC 4 cut(s) 151, 222, 262, 345
LmnI GCTCC 2 cut(s) 178, 368
LweI GCATC 2 cut(s) 48, 344
MaeI CTAG 1 cut(s) 513
MaeIII GTNAC 1 cut(s) 91
MalI GATC 4 cut(s) 153, 224, 264, 347
MboI GATC 4 cut(s) 151, 222, 262, 345
MboII GAAGA 4 cut(s) 72, 158, 464, 500
MluCI AATT 3 cut(s) 125, 217, 398
MnlI CCTC 5 cut(s) 278, 334, 355, 367, 466
MseI TTAA 3 cut(s) 114, 279, 297
MslI CAYNNNNRTG 1 cut(s) 204
MspR9I CCNGG 1 cut(s) 246
MvaI CCWGG 1 cut(s) 246
NcoI CCATGG 1 cut(s) 483
NdeI CATATG 1 cut(s) 429
NdeII GATC 4 cut(s) 151, 222, 262, 345
NlaIII CATG 5 cut(s) 20, 244, 322, 487, 549
NspI RCATGY 1 cut(s) 244
PaeI GCATGC 1 cut(s) 244
PagI TCATGA 1 cut(s) 545
PfeI GAWTC 2 cut(s) 104, 284
Psp6I CCWGG 1 cut(s) 244
PspGI CCWGG 1 cut(s) 244
RsaI GTAC 1 cut(s) 442
RsaNI GTAC 1 cut(s) 441
RseI CAYNNNNRTG 1 cut(s) 204
SaqAI TTAA 3 cut(s) 114, 279, 297
Sau3AI GATC 4 cut(s) 151, 222, 262, 345
ScrFI CCNGG 1 cut(s) 246
SetI ASST 3 cut(s) 175, 420, 505
SfaNI GCATC 2 cut(s) 48, 344
SfcI CTRYAG 1 cut(s) 99
SmiMI CAYNNNNRTG 1 cut(s) 204
SmlI CTYRAG 1 cut(s) 71
SmoI CTYRAG 1 cut(s) 71
SphI GCATGC 1 cut(s) 244
Sse9I AATT 3 cut(s) 125, 217, 398
SspMI CTAG 1 cut(s) 513
StyD4I CCNGG 1 cut(s) 244
StyI CCWWGG 1 cut(s) 483
TasI AATT 3 cut(s) 125, 217, 398
TfiI GAWTC 2 cut(s) 104, 284
Tru1I TTAA 3 cut(s) 114, 279, 297
Tru9I TTAA 3 cut(s) 114, 279, 297
TspDTI ATGAA 5 cut(s) 5, 159, 348, 449, 534
XapI RAATTY 2 cut(s) 125, 217
XceI RCATGY 1 cut(s) 244
XspI CTAG 1 cut(s) 513
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.