Rw0G023530

two-component response regulator

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Contig01090
Physical Location & Seq
Reverse (-)
5954 .. 7166
1213 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw0G023530.1

Sequence Viewer

Length: 462 bp
ATGGTTACTGCTGTAGATTCTGGTATTAAGGCTTTAGAATTTTTGGGTTTGAATGATGAAGAGGATCAAAGTGATATTGCAGAAGCTCCTTCTGTGTCTCCAAACAATCATCATCAGGATGTAGATGTGAATTTGATCATTACAGATTACTGCATGCCAGGAATGACAGGCTATGATCTCCTCAGAAAGATTAAGGAATCCAAGTCTCTTAAAGACATACCAGTTGTTATCATGTCCTCAGAGAATGAACCATCAAGGATCAACAGATGCTTAGAGGAAGGAGCAGAAGAGTTCTTTCTGAAACCAGTAAAATTGTCAGATGTCAACAAGCTTAGACCCCATATGATGAAGGGTACAAGTATAGAAGACGAAGGCAACATCAACGAGGGAAAGGCCATGGAAGAAATCCAAACACCTGAGAGAACTAGAACACTATATAATGGCTTTGATGTGCTTTCATGA

Protein Analysis

153

Amino Acids

17.13

Weight (kDa)

4.58

Isoelectric Point (pI)

53.7

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Response_reg PF00072 36 - 108 1.5e-15 Response regulator receiver domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 72, 266
AcsI RAATTY 2 cut(s) 38, 130
AfaI GTAC 1 cut(s) 355
AgsI TTSAA 1 cut(s) 52
AjnI CCWGG 1 cut(s) 157
AluBI AGCT 2 cut(s) 86, 331
AluI AGCT 2 cut(s) 86, 331
Alw26I GTCTC 2 cut(s) 102, 210
AlwI GGATC 2 cut(s) 72, 266
AoxI GGCC 1 cut(s) 393
ApoI RAATTY 2 cut(s) 38, 130
BbsI GAAGAC 1 cut(s) 372
BccI CCATC 1 cut(s) 259
BciT130I CCWGG 1 cut(s) 159
BclI TGATCA 1 cut(s) 135
BcoDI GTCTC 2 cut(s) 102, 210
BfaI CTAG 1 cut(s) 426
BfmI CTRYAG 1 cut(s) 12
Bme1390I CCNGG 1 cut(s) 159
BmrFI CCNGG 1 cut(s) 159
BmsI GCATC 1 cut(s) 257
BpiI GAAGAC 1 cut(s) 372
BsaJI CCNNGG 1 cut(s) 396
Bse1I ACTGG 2 cut(s) 221, 305
BseBI CCWGG 1 cut(s) 159
BseDI CCNNGG 1 cut(s) 396
BseGI GGATG 1 cut(s) 124
BseMII CTCAG 3 cut(s) 196, 252, 408
BseNI ACTGG 2 cut(s) 221, 305
BseRI GAGGAG 1 cut(s) 170
BshFI GGCC 1 cut(s) 395
BsmAI GTCTC 2 cut(s) 102, 210
BsnI GGCC 1 cut(s) 395
Bsp143I GATC 4 cut(s) 64, 135, 175, 258
Bsp19I CCATGG 1 cut(s) 396
BspANI GGCC 1 cut(s) 395
BspCNI CTCAG 3 cut(s) 195, 251, 409
BspHI TCATGA 1 cut(s) 458
BspPI GGATC 2 cut(s) 72, 266
BsrI ACTGG 2 cut(s) 221, 305
BssECI CCNNGG 1 cut(s) 396
BssMI GATC 4 cut(s) 64, 135, 175, 258
BssT1I CCWWGG 1 cut(s) 396
Bst2UI CCWGG 1 cut(s) 159
Bst6I CTCTTC 2 cut(s) 54, 282
BstC8I GCNNGC 1 cut(s) 155
BstDEI CTNAG 5 cut(s) 182, 238, 271, 332, 417
BstDSI CCRYGG 1 cut(s) 396
BstF5I GGATG 1 cut(s) 124
BstKTI GATC 4 cut(s) 67, 138, 178, 261
BstMAI GTCTC 2 cut(s) 102, 210
BstMBI GATC 4 cut(s) 64, 135, 175, 258
BstNI CCWGG 1 cut(s) 159
BstNSI RCATGY 1 cut(s) 157
BstSCI CCNGG 1 cut(s) 157
BstSFI CTRYAG 1 cut(s) 12
BstV2I GAAGAC 1 cut(s) 372
BsuRI GGCC 1 cut(s) 395
BtgI CCRYGG 1 cut(s) 396
BtsCI GGATG 1 cut(s) 124
Cac8I GCNNGC 1 cut(s) 155
CciI TCATGA 1 cut(s) 458
Csp6I GTAC 1 cut(s) 354
CviAII CATG 4 cut(s) 154, 232, 397, 459
CviJI RGCY 6 cut(s) 32, 86, 171, 331, 395, 444
CviKI_1 RGCY 6 cut(s) 32, 86, 171, 331, 395, 444
CviQI GTAC 1 cut(s) 354
DdeI CTNAG 5 cut(s) 182, 238, 271, 332, 417
DpnI GATC 4 cut(s) 66, 137, 177, 260
DpnII GATC 4 cut(s) 64, 135, 175, 258
Eam1104I CTCTTC 2 cut(s) 54, 282
EarI CTCTTC 2 cut(s) 54, 282
Eco130I CCWWGG 1 cut(s) 396
EcoRII CCWGG 1 cut(s) 157
EcoT14I CCWWGG 1 cut(s) 396
ErhI CCWWGG 1 cut(s) 396
FaeI CATG 4 cut(s) 157, 235, 400, 462
FatI CATG 4 cut(s) 153, 231, 396, 458
FauNDI CATATG 1 cut(s) 342
FbaI TGATCA 1 cut(s) 135
FokI GGATG 1 cut(s) 131
FspBI CTAG 1 cut(s) 426
HaeIII GGCC 1 cut(s) 395
Hin1II CATG 4 cut(s) 157, 235, 400, 462
HincII GTYRAC 1 cut(s) 325
HindII GTYRAC 1 cut(s) 325
HindIII AAGCTT 1 cut(s) 329
HinfI GANTC 2 cut(s) 17, 197
Hpy166II GTNNAC 1 cut(s) 325
Hpy188I TCNGA 4 cut(s) 185, 241, 300, 319
Hpy188III TCNNGA 2 cut(s) 116, 459
Hpy8I GTNNAC 1 cut(s) 325
HpyAV CCTTC 4 cut(s) 99, 272, 343, 365
HpyCH4V TGCA 2 cut(s) 80, 153
HpyF3I CTNAG 5 cut(s) 182, 238, 271, 332, 417
Hsp92II CATG 4 cut(s) 157, 235, 400, 462
Ksp22I TGATCA 1 cut(s) 135
Kzo9I GATC 4 cut(s) 64, 135, 175, 258
LmnI GCTCC 2 cut(s) 91, 281
LpnPI CCDG 8 cut(s) 6, 101, 144, 153, 171, 234, 318, 429
LweI GCATC 1 cut(s) 257
MaeI CTAG 1 cut(s) 426
MaeIII GTNAC 1 cut(s) 4
MalI GATC 4 cut(s) 66, 137, 177, 260
MboI GATC 4 cut(s) 64, 135, 175, 258
MboII GAAGA 4 cut(s) 71, 299, 377, 413
MluCI AATT 3 cut(s) 38, 130, 311
MnlI CCTC 5 cut(s) 55, 191, 247, 268, 379
MseI TTAA 3 cut(s) 27, 192, 210
MslI CAYNNNNRTG 1 cut(s) 117
MspR9I CCNGG 1 cut(s) 159
MvaI CCWGG 1 cut(s) 159
NcoI CCATGG 1 cut(s) 396
NdeI CATATG 1 cut(s) 342
NdeII GATC 4 cut(s) 64, 135, 175, 258
NlaIII CATG 4 cut(s) 157, 235, 400, 462
NspI RCATGY 1 cut(s) 157
PaeI GCATGC 1 cut(s) 157
PagI TCATGA 1 cut(s) 458
PfeI GAWTC 2 cut(s) 17, 197
Psp6I CCWGG 1 cut(s) 157
PspGI CCWGG 1 cut(s) 157
RsaI GTAC 1 cut(s) 355
RsaNI GTAC 1 cut(s) 354
RseI CAYNNNNRTG 1 cut(s) 117
SaqAI TTAA 3 cut(s) 27, 192, 210
Sau3AI GATC 4 cut(s) 64, 135, 175, 258
ScrFI CCNGG 1 cut(s) 159
SetI ASST 3 cut(s) 88, 333, 418
SfaNI GCATC 1 cut(s) 257
SfcI CTRYAG 1 cut(s) 12
SmiMI CAYNNNNRTG 1 cut(s) 117
SphI GCATGC 1 cut(s) 157
Sse9I AATT 3 cut(s) 38, 130, 311
SspMI CTAG 1 cut(s) 426
StyD4I CCNGG 1 cut(s) 157
StyI CCWWGG 1 cut(s) 396
TasI AATT 3 cut(s) 38, 130, 311
TfiI GAWTC 2 cut(s) 17, 197
Tru1I TTAA 3 cut(s) 27, 192, 210
Tru9I TTAA 3 cut(s) 27, 192, 210
TspDTI ATGAA 4 cut(s) 72, 261, 362, 447
XapI RAATTY 2 cut(s) 38, 130
XceI RCATGY 1 cut(s) 157
XspI CTAG 1 cut(s) 426
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.