Prupe.2G200700_v2.0.a1

Soluble inorganic

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp02
OG0004908
Physical Location & Seq
Forward (+)
23755414 .. 23757786
2373 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.2G200700.2

Sequence Viewer

Length: 723 bp
ATGTTGATTTACCTCAAATCTTCTAGGAATCTTGATGCCTACATCTTCGTCACCTCTCCTTCAGTTACCATATCTAGAATGATGGCTGATGAAGAAAGTGAAGTTCAAGCAGTACCACGCCAAAAAGCTCCCAAGTTAAATGAGAGGATTCTTTCATCTCTGTCGAGGAAATCAGTTGCTGCACATCCGTGGCATGATCTTGAAATTGGACCTAAAGCTCCCTATATTTTCAATTGTGTTGTTGAGATAACAAAGGGAAGCAAGGTCAAATATGAGCTTGACAAGAAGACAGGACTAATTAAGGTTGATCGGATTTTGTACTCGTCAGTGGTCTATCCTCATAACTATGGTTTCATCCCTCGCACCTTGTGTGAAGACAATGATCCACTGGATGTGTTAGTTCTCATGCAGGAACCTGTTCTTCCTGGTTGTTTTCTGAGAGCCAAAGCCATTGGACTAATGCCTATGATTGACCAGGGAGAGAAAGATGACAAGATCATTGCAGTCTGTGCCGATGATCCAGCTTATAATCACTACACTGACATCAAAGAGCTTCCCCCTCATCGCCTTTGTGAGATTCGTCGCTTCTTTGAAGACTACAAGAAGAATGAGAACAAAGAGGTTGCAGTTGACCAGTTTTTGCCTTCCCACAATGCTGCTGAAGCCATCCAGTACTCTATGGACCTTTATGCAGAGTACATAATGCTCACCCTAAGGCGATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0044424 GO:0044464
KEGG Pathways
Metabolic & Signaling
ko00190 map00190
Pfam Domains
Protein Families
Pyrophosphatase

Protein Analysis

241

Amino Acids

27.53

Weight (kDa)

6.1

Isoelectric Point (pI)

41.14

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 528
AclWI GGATC 2 cut(s) 377, 512
AcuI CTGAAG 2 cut(s) 45, 681
AdeI CACNNNGTG 1 cut(s) 369
AfaI GTAC 4 cut(s) 114, 320, 674, 698
AgsI TTSAA 4 cut(s) 107, 203, 232, 593
AjnI CCWGG 2 cut(s) 424, 474
AleI CACNNNNGTG 1 cut(s) 187
AluBI AGCT 5 cut(s) 128, 218, 277, 524, 553
AluI AGCT 5 cut(s) 128, 218, 277, 524, 553
AlwI GGATC 2 cut(s) 377, 512
AlwNI CAGNNNCTG 1 cut(s) 179
ApeKI GCWGC 2 cut(s) 179, 656
Asp700I GAANNNNTTC 1 cut(s) 417
AspS9I GGNCC 2 cut(s) 209, 682
AsuHPI GGTGA 2 cut(s) 43, 700
AvaII GGWCC 2 cut(s) 209, 682
AxyI CCTNAGG 1 cut(s) 713
BbsI GAAGAC 3 cut(s) 293, 381, 600
BbvI GCAGC 2 cut(s) 166, 643
BccI CCATC 2 cut(s) 76, 674
BciT130I CCWGG 2 cut(s) 426, 476
BfaI CTAG 2 cut(s) 24, 75
BisI GCNGC 2 cut(s) 180, 657
BlsI GCNGC 2 cut(s) 181, 658
BmcAI AGTACT 1 cut(s) 674
Bme1390I CCNGG 2 cut(s) 426, 476
Bme18I GGWCC 2 cut(s) 209, 682
BmgT120I GGNCC 2 cut(s) 209, 682
BmiI GGNNCC 1 cut(s) 414
BmrFI CCNGG 2 cut(s) 426, 476
BmsI GCATC 1 cut(s) 25
BpiI GAAGAC 3 cut(s) 293, 381, 600
BsaJI CCNNGG 2 cut(s) 188, 475
Bse1I ACTGG 3 cut(s) 393, 634, 670
Bse21I CCTNAGG 1 cut(s) 713
Bse3DI GCAATG 1 cut(s) 498
BseBI CCWGG 2 cut(s) 426, 476
BseDI CCNNGG 2 cut(s) 188, 475
BseGI GGATG 4 cut(s) 184, 354, 397, 666
BseMI GCAATG 1 cut(s) 498
BseMII CTCAG 1 cut(s) 428
BseNI ACTGG 3 cut(s) 393, 634, 670
BseXI GCAGC 2 cut(s) 166, 643
BsgI GTGCAG 1 cut(s) 165
Bsp143I GATC 5 cut(s) 196, 307, 382, 495, 517
BspCNI CTCAG 1 cut(s) 429
BspLI GGNNCC 1 cut(s) 414
BspPI GGATC 2 cut(s) 377, 512
BsrDI GCAATG 1 cut(s) 498
BsrI ACTGG 3 cut(s) 393, 634, 670
BssECI CCNNGG 2 cut(s) 188, 475
BssMI GATC 5 cut(s) 196, 307, 382, 495, 517
Bst2UI CCWGG 2 cut(s) 426, 476
BstAPI GCANNNNNTGC 1 cut(s) 509
BstDEI CTNAG 2 cut(s) 437, 713
BstDSI CCRYGG 1 cut(s) 188
BstF5I GGATG 4 cut(s) 184, 354, 397, 666
BstKTI GATC 5 cut(s) 199, 310, 385, 498, 520
BstMBI GATC 5 cut(s) 196, 307, 382, 495, 517
BstMWI GCNNNNNNNGC 2 cut(s) 509, 662
BstNI CCWGG 2 cut(s) 426, 476
BstSCI CCNGG 2 cut(s) 424, 474
BstV1I GCAGC 2 cut(s) 166, 643
BstV2I GAAGAC 3 cut(s) 293, 381, 600
Bsu36I CCTNAGG 1 cut(s) 713
BtgI CCRYGG 1 cut(s) 188
BtgZI GCGATG 1 cut(s) 548
BtsCI GGATG 4 cut(s) 184, 354, 397, 666
BtsIMutI CAGTG 3 cut(s) 333, 386, 537
CaiI CAGNNNCTG 1 cut(s) 179
Cfr13I GGNCC 2 cut(s) 209, 682
Csp6I GTAC 4 cut(s) 113, 319, 673, 697
CviAII CATG 2 cut(s) 194, 406
CviJI RGCY 9 cut(s) 86, 128, 218, 277, 443, 449, 524, 553, 665
CviKI_1 RGCY 9 cut(s) 86, 128, 218, 277, 443, 449, 524, 553, 665
CviQI GTAC 4 cut(s) 113, 319, 673, 697
DdeI CTNAG 2 cut(s) 437, 713
DpnI GATC 5 cut(s) 198, 309, 384, 497, 519
DpnII GATC 5 cut(s) 196, 307, 382, 495, 517
DraIII CACNNNGTG 1 cut(s) 369
Eco47I GGWCC 2 cut(s) 209, 682
Eco57I CTGAAG 2 cut(s) 45, 681
Eco81I CCTNAGG 1 cut(s) 713
EcoRII CCWGG 2 cut(s) 424, 474
FaeI CATG 2 cut(s) 197, 409
FatI CATG 2 cut(s) 193, 405
Fnu4HI GCNGC 2 cut(s) 180, 657
FokI GGATG 4 cut(s) 171, 341, 404, 653
Fsp4HI GCNGC 2 cut(s) 180, 657
FspBI CTAG 2 cut(s) 24, 75
GluI GCNGC 2 cut(s) 180, 657
Hin1II CATG 2 cut(s) 197, 409
HincII GTYRAC 1 cut(s) 631
HindII GTYRAC 1 cut(s) 631
HinfI GANTC 3 cut(s) 28, 148, 577
HphI GGTGA 2 cut(s) 43, 700
Hpy166II GTNNAC 1 cut(s) 631
Hpy188I TCNGA 2 cut(s) 312, 438
Hpy188III TCNNGA 3 cut(s) 32, 75, 200
Hpy8I GTNNAC 1 cut(s) 631
Hpy99I CGWCG 1 cut(s) 585
HpyAV CCTTC 2 cut(s) 69, 654
HpyCH4V TGCA 5 cut(s) 182, 409, 503, 626, 692
HpyF10VI GCNNNNNNNGC 2 cut(s) 509, 662
HpyF3I CTNAG 2 cut(s) 437, 713
Hsp92II CATG 2 cut(s) 197, 409
Kzo9I GATC 5 cut(s) 196, 307, 382, 495, 517
LmnI GCTCC 2 cut(s) 133, 223
Lsp1109I GCAGC 2 cut(s) 166, 643
LweI GCATC 1 cut(s) 25
MaeI CTAG 2 cut(s) 24, 75
MaeIII GTNAC 2 cut(s) 49, 64
MalI GATC 5 cut(s) 198, 309, 384, 497, 519
MboI GATC 5 cut(s) 196, 307, 382, 495, 517
MboII GAAGA 8 cut(s) 12, 37, 104, 298, 386, 413, 605, 616
MfeI CAATTG 1 cut(s) 232
MluCI AATT 3 cut(s) 204, 232, 297
MnlI CCTC 8 cut(s) 23, 64, 138, 159, 348, 369, 570, 613
MroXI GAANNNNTTC 1 cut(s) 417
MseI TTAA 2 cut(s) 137, 300
MslI CAYNNNNRTG 2 cut(s) 187, 345
MspR9I CCNGG 2 cut(s) 426, 476
MunI CAATTG 1 cut(s) 232
MvaI CCWGG 2 cut(s) 426, 476
MwoI GCNNNNNNNGC 2 cut(s) 509, 662
NdeII GATC 5 cut(s) 196, 307, 382, 495, 517
NlaIII CATG 2 cut(s) 197, 409
NlaIV GGNNCC 1 cut(s) 414
NmuCI GTSAC 1 cut(s) 49
OliI CACNNNNGTG 1 cut(s) 187
PdmI GAANNNNTTC 1 cut(s) 417
PfeI GAWTC 3 cut(s) 28, 148, 577
PkrI GCNGC 2 cut(s) 181, 658
PsiI TTATAA 1 cut(s) 528
Psp6I CCWGG 2 cut(s) 424, 474
PspGI CCWGG 2 cut(s) 424, 474
PspN4I GGNNCC 1 cut(s) 414
PspPI GGNCC 2 cut(s) 209, 682
PstNI CAGNNNCTG 1 cut(s) 179
RsaI GTAC 4 cut(s) 114, 320, 674, 698
RsaNI GTAC 4 cut(s) 113, 319, 673, 697
RseI CAYNNNNRTG 2 cut(s) 187, 345
SaqAI TTAA 2 cut(s) 137, 300
SatI GCNGC 2 cut(s) 180, 657
Sau3AI GATC 5 cut(s) 196, 307, 382, 495, 517
Sau96I GGNCC 2 cut(s) 209, 682
ScaI AGTACT 1 cut(s) 674
ScrFI CCNGG 2 cut(s) 426, 476
SfaNI GCATC 1 cut(s) 25
SinI GGWCC 2 cut(s) 209, 682
SmiMI CAYNNNNRTG 2 cut(s) 187, 345
Sse9I AATT 3 cut(s) 204, 232, 297
SspMI CTAG 2 cut(s) 24, 75
StyD4I CCNGG 2 cut(s) 424, 474
TaqI TCGA 1 cut(s) 164
TasI AATT 3 cut(s) 204, 232, 297
TatI WGTACW 3 cut(s) 318, 672, 696
TfiI GAWTC 3 cut(s) 28, 148, 577
Tru1I TTAA 2 cut(s) 137, 300
Tru9I TTAA 2 cut(s) 137, 300
TscAI CASTG 3 cut(s) 333, 393, 544
TseFI GTSAC 1 cut(s) 49
TseI GCWGC 2 cut(s) 179, 656
Tsp45I GTSAC 1 cut(s) 49
TspDTI ATGAA 3 cut(s) 105, 144, 343
TspGWI ACGGA 1 cut(s) 177
TspRI CASTG 3 cut(s) 333, 393, 544
VpaK11BI GGWCC 2 cut(s) 209, 682
XbaI TCTAGA 1 cut(s) 74
XmnI GAANNNNTTC 1 cut(s) 417
XspI CTAG 2 cut(s) 24, 75
ZrmI AGTACT 1 cut(s) 674
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.