Rmu_sc0002119.1_g000027

Soluble inorganic

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002119.1
Physical Location & Seq
Reverse (-)
139950 .. 142104
2155 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002119.1_g000027.1.cds

Sequence Viewer

Length: 819 bp
atgacttctgaggagaatgatgaaaaaccacataaaccaactcccaagttaaatgagaggattctttcatctttgtcaaggagatcagttgctgcacatccttggcacgatcttgaaattggtcctacagctccacatattttcaatgtggttgttgagattacaaagggaagcaaagtcaaatacgaacttgacaagaagacaggattaattaaggttgatcggattttgtactcgtctgtggtctatcctcataactatggcttcatccctcgcaccttgtgtgaagacaatgatccacttgatgttctagtcctcatgcaggaacctgtccttcctggttgctttctgcgagcaagagccattggagtgatgcctatgattgaccagggagagaaagatgataagatcattgcagtctgtgctgacgatccagagtatacgcattatactgaactcaatgacctaccccctcaccgcctttctgaaatccgtcgcttctttgaagactacaagaaaaatgagaacaaagaggttgcggtgaacgcctttttgcctgccacatccgctcttgaagctatccagtactccatggatctttatgctgagtacatactgcacaccttaaggcgtatgtctggtttaagcactattcaaggaagtatcatgttcagagcttatagcttcaatgttacagatgaggtcaaaggagaaggggaaggttcaaactctgaccttggttggagccttggagggaaaaatcctccctccacttcagttaccacaacaggagttcaactttcaatctcattaatgtag

Protein Analysis

272

Amino Acids

30.52

Weight (kDa)

5.42

Isoelectric Point (pI)

40.2

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 569
AccI GTMKAC 1 cut(s) 440
AciI CCGC 3 cut(s) 478, 539, 567
AclWI GGATC 3 cut(s) 290, 425, 603
AcuI CTGAAG 1 cut(s) 759
AdeI CACNNNGTG 1 cut(s) 282
AfaI GTAC 3 cut(s) 233, 587, 611
AfiI CCNNNNNNNGG 1 cut(s) 322
AflII CTTAAG 1 cut(s) 625
AgsI TTSAA 9 cut(s) 116, 145, 506, 575, 656, 688, 726, 797, 804
AjnI CCWGG 2 cut(s) 337, 387
AluBI AGCT 4 cut(s) 131, 578, 677, 684
AluI AGCT 4 cut(s) 131, 578, 677, 684
AlwI GGATC 3 cut(s) 290, 425, 603
AlwNI CAGNNNCTG 1 cut(s) 92
ApeKI GCWGC 1 cut(s) 92
AseI ATTAAT 2 cut(s) 209, 812
AspS9I GGNCC 1 cut(s) 122
AsuHPI GGTGA 2 cut(s) 467, 553
AvaII GGWCC 1 cut(s) 122
BbsI GAAGAC 3 cut(s) 206, 294, 513
BbvI GCAGC 1 cut(s) 79
BciT130I CCWGG 2 cut(s) 339, 389
BfaI CTAG 1 cut(s) 311
BfmI CTRYAG 1 cut(s) 126
BfrI CTTAAG 1 cut(s) 625
BisI GCNGC 1 cut(s) 93
BlsI GCNGC 1 cut(s) 94
BmcAI AGTACT 1 cut(s) 587
Bme1390I CCNGG 2 cut(s) 339, 389
Bme18I GGWCC 1 cut(s) 122
BmgT120I GGNCC 1 cut(s) 122
BmiI GGNNCC 2 cut(s) 327, 746
BmrFI CCNGG 2 cut(s) 339, 389
BmsI GCATC 1 cut(s) 363
BpiI GAAGAC 3 cut(s) 206, 294, 513
BsaJI CCNNGG 5 cut(s) 101, 388, 591, 736, 748
Bsc4I CCNNNNNNNGG 1 cut(s) 322
Bse1I ACTGG 1 cut(s) 583
Bse3DI GCAATG 1 cut(s) 411
BseBI CCWGG 2 cut(s) 339, 389
BseDI CCNNGG 5 cut(s) 101, 388, 591, 736, 748
BseGI GGATG 3 cut(s) 97, 267, 563
BseLI CCNNNNNNNGG 1 cut(s) 322
BseMI GCAATG 1 cut(s) 411
BseMII CTCAG 1 cut(s) 597
BseNI ACTGG 1 cut(s) 583
BseRI GAGGAG 1 cut(s) 26
BseXI GCAGC 1 cut(s) 79
BsgI GTGCAG 2 cut(s) 78, 602
BslI CCNNNNNNNGG 1 cut(s) 322
Bsp143I GATC 7 cut(s) 83, 109, 220, 295, 408, 430, 595
Bsp19I CCATGG 1 cut(s) 591
BspACI CCGC 3 cut(s) 478, 539, 567
BspCNI CTCAG 1 cut(s) 598
BspLI GGNNCC 2 cut(s) 327, 746
BspPI GGATC 3 cut(s) 290, 425, 603
BspTI CTTAAG 1 cut(s) 625
BsrBI CCGCTC 1 cut(s) 569
BsrDI GCAATG 1 cut(s) 411
BsrI ACTGG 1 cut(s) 583
BssECI CCNNGG 5 cut(s) 101, 388, 591, 736, 748
BssMI GATC 7 cut(s) 83, 109, 220, 295, 408, 430, 595
BssNAI GTATAC 1 cut(s) 441
BssT1I CCWWGG 4 cut(s) 101, 591, 736, 748
Bst1107I GTATAC 1 cut(s) 441
Bst2UI CCWGG 2 cut(s) 339, 389
BstAFI CTTAAG 1 cut(s) 625
BstAPI GCANNNNNTGC 1 cut(s) 422
BstC8I GCNNGC 2 cut(s) 354, 558
BstDEI CTNAG 2 cut(s) 9, 606
BstDSI CCRYGG 1 cut(s) 591
BstENI CCTNNNNNAGG 1 cut(s) 320
BstF5I GGATG 3 cut(s) 97, 267, 563
BstKTI GATC 7 cut(s) 86, 112, 223, 298, 411, 433, 598
BstMBI GATC 7 cut(s) 83, 109, 220, 295, 408, 430, 595
BstMWI GCNNNNNNNGC 4 cut(s) 422, 545, 566, 575
BstNI CCWGG 2 cut(s) 339, 389
BstSCI CCNGG 2 cut(s) 337, 387
BstSFI CTRYAG 1 cut(s) 126
BstV1I GCAGC 1 cut(s) 79
BstV2I GAAGAC 3 cut(s) 206, 294, 513
BstX2I RGATCY 1 cut(s) 595
BstYI RGATCY 1 cut(s) 595
BstZ17I GTATAC 1 cut(s) 441
BtgI CCRYGG 1 cut(s) 591
BtsCI GGATG 3 cut(s) 97, 267, 563
Cac8I GCNNGC 2 cut(s) 354, 558
CaiI CAGNNNCTG 1 cut(s) 92
Cfr13I GGNCC 1 cut(s) 122
Csp6I GTAC 3 cut(s) 232, 586, 610
CviAII CATG 3 cut(s) 319, 592, 667
CviJI RGCY 7 cut(s) 131, 264, 362, 578, 677, 684, 747
CviKI_1 RGCY 7 cut(s) 131, 264, 362, 578, 677, 684, 747
CviQI GTAC 3 cut(s) 232, 586, 610
DdeI CTNAG 2 cut(s) 9, 606
DpnI GATC 7 cut(s) 85, 111, 222, 297, 410, 432, 597
DpnII GATC 7 cut(s) 83, 109, 220, 295, 408, 430, 595
DraIII CACNNNGTG 1 cut(s) 282
Eco130I CCWWGG 4 cut(s) 101, 591, 736, 748
Eco47I GGWCC 1 cut(s) 122
Eco57I CTGAAG 1 cut(s) 759
EcoNI CCTNNNNNAGG 1 cut(s) 320
EcoRII CCWGG 2 cut(s) 337, 387
EcoT14I CCWWGG 4 cut(s) 101, 591, 736, 748
ErhI CCWWGG 4 cut(s) 101, 591, 736, 748
FaeI CATG 3 cut(s) 322, 595, 670
FatI CATG 3 cut(s) 318, 591, 666
FblI GTMKAC 1 cut(s) 440
Fnu4HI GCNGC 1 cut(s) 93
FokI GGATG 3 cut(s) 84, 254, 550
Fsp4HI GCNGC 1 cut(s) 93
FspBI CTAG 1 cut(s) 311
GluI GCNGC 1 cut(s) 93
Hin1II CATG 3 cut(s) 322, 595, 670
HinfI GANTC 1 cut(s) 61
HphI GGTGA 2 cut(s) 467, 553
Hpy166II GTNNAC 2 cut(s) 441, 544
Hpy188I TCNGA 5 cut(s) 10, 225, 487, 674, 733
Hpy188III TCNNGA 3 cut(s) 113, 434, 572
Hpy8I GTNNAC 2 cut(s) 441, 544
Hpy99I CGWCG 1 cut(s) 498
HpyAV CCTTC 3 cut(s) 344, 707, 713
HpyCH4V TGCA 4 cut(s) 95, 322, 416, 619
HpyF10VI GCNNNNNNNGC 4 cut(s) 422, 545, 566, 575
HpyF3I CTNAG 2 cut(s) 9, 606
Hsp92II CATG 3 cut(s) 322, 595, 670
Kzo9I GATC 7 cut(s) 83, 109, 220, 295, 408, 430, 595
LmnI GCTCC 2 cut(s) 136, 744
Lsp1109I GCAGC 1 cut(s) 79
LweI GCATC 1 cut(s) 363
MaeI CTAG 1 cut(s) 311
MaeIII GTNAC 2 cut(s) 691, 778
MalI GATC 7 cut(s) 85, 111, 222, 297, 410, 432, 597
MbiI CCGCTC 1 cut(s) 569
MboI GATC 7 cut(s) 83, 109, 220, 295, 408, 430, 595
MboII GAAGA 3 cut(s) 211, 299, 518
MflI RGATCY 1 cut(s) 595
MluCI AATT 2 cut(s) 117, 210
MmeI TCCRAC 1 cut(s) 722
MseI TTAA 6 cut(s) 50, 209, 213, 626, 644, 812
MslI CAYNNNNRTG 2 cut(s) 258, 368
MspCI CTTAAG 1 cut(s) 625
MspR9I CCNGG 2 cut(s) 339, 389
MvaI CCWGG 2 cut(s) 339, 389
MwoI GCNNNNNNNGC 4 cut(s) 422, 545, 566, 575
NcoI CCATGG 1 cut(s) 591
NdeII GATC 7 cut(s) 83, 109, 220, 295, 408, 430, 595
NlaIII CATG 3 cut(s) 322, 595, 670
NlaIV GGNNCC 2 cut(s) 327, 746
PacI TTAATTAA 1 cut(s) 213
PfeI GAWTC 1 cut(s) 61
PkrI GCNGC 1 cut(s) 94
PshBI ATTAAT 2 cut(s) 209, 812
Psp6I CCWGG 2 cut(s) 337, 387
PspGI CCWGG 2 cut(s) 337, 387
PspN4I GGNNCC 2 cut(s) 327, 746
PspPI GGNCC 1 cut(s) 122
PstNI CAGNNNCTG 1 cut(s) 92
PsuI RGATCY 1 cut(s) 595
RsaI GTAC 3 cut(s) 233, 587, 611
RsaNI GTAC 3 cut(s) 232, 586, 610
RseI CAYNNNNRTG 2 cut(s) 258, 368
SaqAI TTAA 6 cut(s) 50, 209, 213, 626, 644, 812
SatI GCNGC 1 cut(s) 93
Sau3AI GATC 7 cut(s) 83, 109, 220, 295, 408, 430, 595
Sau96I GGNCC 1 cut(s) 122
ScaI AGTACT 1 cut(s) 587
ScrFI CCNGG 2 cut(s) 339, 389
SfaNI GCATC 1 cut(s) 363
SfcI CTRYAG 1 cut(s) 126
SinI GGWCC 1 cut(s) 122
SmiMI CAYNNNNRTG 2 cut(s) 258, 368
SmlI CTYRAG 1 cut(s) 625
SmoI CTYRAG 1 cut(s) 625
Sse9I AATT 2 cut(s) 117, 210
SsiI CCGC 3 cut(s) 478, 539, 567
SspMI CTAG 1 cut(s) 311
StyD4I CCNGG 2 cut(s) 337, 387
StyI CCWWGG 4 cut(s) 101, 591, 736, 748
TasI AATT 2 cut(s) 117, 210
TatI WGTACW 3 cut(s) 231, 585, 609
TfiI GAWTC 1 cut(s) 61
Tru1I TTAA 6 cut(s) 50, 209, 213, 626, 644, 812
Tru9I TTAA 6 cut(s) 50, 209, 213, 626, 644, 812
TseI GCWGC 1 cut(s) 92
TspDTI ATGAA 3 cut(s) 36, 57, 256
TspGWI ACGGA 1 cut(s) 482
Vha464I CTTAAG 1 cut(s) 625
VpaK11BI GGWCC 1 cut(s) 122
VspI ATTAAT 2 cut(s) 209, 812
XagI CCTNNNNNAGG 1 cut(s) 320
XmiI GTMKAC 1 cut(s) 440
XspI CTAG 1 cut(s) 311
ZrmI AGTACT 1 cut(s) 587
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.