Basic Information

Type: gene

Biological Identity

Species

rosa_wichuraiana

Chromosome

Chr1

Orthogroup ID

OG0004908

Physical Location & Seq

Genomic Coordinates Forward (+)

53674474 .. 53677309

Gene Structure 2836 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rw1G026530.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 636 bp

ATGACTTCTGAGGAAAATGATGAAAAACCACATAAACCAACTCCCAAGTTAAATGAGAGGATTCTTTCATCTTTATCAAGGAGATCAGTTGCTGCACATCCTTGGCACGATCTTGAAATTGGTCCTACAGCCCCACATATTTTCAATGTGGTTGTTGAGATTACAAAGGGAAGCAAAGTCAAATACGAACTTGACAAGAAGACAGGATTAATTAAGGTTGATCGGATTTTGTACTCGTCTGTGGTCTATCCTCATAACTATGGCTTCATCCCTCGCACCTTGTGTGAAGACAATGATCCACTTGATGTTCTAGTCCTCATGCAGGAACCTGTCCTTCCTGGTTGCTTTCTGCGAGCAAGAGCCATTGGAGTGATGCCTATGATTGACCAGGGAGAGAAAGATGATAAGATCATTGCAGTCTGTGCTGACGATCCAGAGTATACGCATTATACTGAACTCAATGACCTACCCCCTCACCGCCTTTCTGAAATCCGTCGCTTCTTTGAAGACTACAAGAAAAATGAGAACAAAGAGGTTGCGGTTAACGCCTTTTTGCCTGCCACATCCGCTCTTGAAGCTATCCAGTACTCCATGGATCTTTATGCTGAGTACATACTGCACACCTTAAGGCGGTAA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0004427 GO:0005575 GO:0005622 GO:0005623 GO:0005634 GO:0005737 GO:0005829 GO:0008150 GO:0010876 GO:0016462 GO:0016787 GO:0016817 GO:0016818 GO:0019915 GO:0033036 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044424 GO:0044444 GO:0044464 GO:0051179 GO:0051235 GO:0065007 GO:0065008

KEGG Pathways

Metabolic & Signaling

ko00190 map00190

Pfam Domains

Protein Families

Pyrophosphatase

Protein Analysis

211

Amino Acids

24.21

Weight (kDa)

5.63

Isoelectric Point (pI)

46.85

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
Pyrophosphatase	PF00719	50 - 201	1.3e-59	Inorganic pyrophosphatase

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0004908)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G01050 AT1G01050 AT2G46860 AT4G01480 AT4G01480
fragaria_vesca	FvH4_7g17871 FvH4_7g17880 FvH4_7g17880 FvH4_7g17880
malus_domestica	MD01G1091200.v1.1 MD01G1091400.v1.1 MD07G1161500.v1.1
prunus_persica	Prupe.2G200700_v2.0.a1 Prupe.2G200700_v2.0.a1 Prupe.2G200800_v2.0.a1 Prupe.2G200800_v2.0.a1
pyrus_communis	pycom01g11550
rosa_chinensis	RchiOBHm_Chr1g0361351
rosa_laevigata	RLG00000027723 RLG00000027724
rosa_multiflora	Rmu_sc0002119.1_g000027
rosa_roxburghii	Rroxscaffold_4G00295030
rosa_rugosa	Rorug01G0288300 Rorug01G0288400 Rorug01G0288500 Rorug01G0288800
rosa_samantha	Rh1AG299600 Rh1BG263400
rosa_wichuraiana	Rw1G026520 Rw1G026530

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccBSI	CCGCTC	1 cut(s)	569
AccI	GTMKAC	1 cut(s)	440
AciI	CCGC	4 cut(s)	478, 539, 567, 631
AclWI	GGATC	3 cut(s)	290, 425, 603
AdeI	CACNNNGTG	1 cut(s)	282
AfaI	GTAC	3 cut(s)	233, 587, 611
AfiI	CCNNNNNNNGG	2 cut(s)	322, 630
AflII	CTTAAG	1 cut(s)	625
AgsI	TTSAA	4 cut(s)	116, 145, 506, 575
AjnI	CCWGG	2 cut(s)	337, 387
AluBI	AGCT	1 cut(s)	578
AluI	AGCT	1 cut(s)	578
AlwI	GGATC	3 cut(s)	290, 425, 603
AlwNI	CAGNNNCTG	1 cut(s)	92
ApeKI	GCWGC	1 cut(s)	92
AseI	ATTAAT	1 cut(s)	209
AspS9I	GGNCC	1 cut(s)	122
AsuHPI	GGTGA	1 cut(s)	467
AvaII	GGWCC	1 cut(s)	122
BbsI	GAAGAC	3 cut(s)	206, 294, 513
BbvI	GCAGC	1 cut(s)	79
BciT130I	CCWGG	2 cut(s)	339, 389
BfaI	CTAG	1 cut(s)	311
BfmI	CTRYAG	1 cut(s)	126
BfrI	CTTAAG	1 cut(s)	625
BisI	GCNGC	1 cut(s)	93
BlsI	GCNGC	1 cut(s)	94
BmcAI	AGTACT	1 cut(s)	587
Bme1390I	CCNGG	2 cut(s)	339, 389
Bme18I	GGWCC	1 cut(s)	122
BmgT120I	GGNCC	1 cut(s)	122
BmiI	GGNNCC	1 cut(s)	327
BmrFI	CCNGG	2 cut(s)	339, 389
BmsI	GCATC	1 cut(s)	363
BpiI	GAAGAC	3 cut(s)	206, 294, 513
BsaJI	CCNNGG	3 cut(s)	101, 388, 591
Bsc4I	CCNNNNNNNGG	2 cut(s)	322, 630
Bse1I	ACTGG	1 cut(s)	583
Bse3DI	GCAATG	1 cut(s)	411
BseBI	CCWGG	2 cut(s)	339, 389
BseDI	CCNNGG	3 cut(s)	101, 388, 591
BseGI	GGATG	3 cut(s)	97, 267, 563
BseLI	CCNNNNNNNGG	2 cut(s)	322, 630
BseMI	GCAATG	1 cut(s)	411
BseMII	CTCAG	1 cut(s)	597
BseNI	ACTGG	1 cut(s)	583
BseXI	GCAGC	1 cut(s)	79
BsgI	GTGCAG	2 cut(s)	78, 602
BslI	CCNNNNNNNGG	2 cut(s)	322, 630
Bsp143I	GATC	7 cut(s)	83, 109, 220, 295, 408, 430, 595
Bsp19I	CCATGG	1 cut(s)	591
BspACI	CCGC	4 cut(s)	478, 539, 567, 631
BspCNI	CTCAG	1 cut(s)	598
BspLI	GGNNCC	1 cut(s)	327
BspPI	GGATC	3 cut(s)	290, 425, 603
BspTI	CTTAAG	1 cut(s)	625
BsrBI	CCGCTC	1 cut(s)	569
BsrDI	GCAATG	1 cut(s)	411
BsrI	ACTGG	1 cut(s)	583
BssECI	CCNNGG	3 cut(s)	101, 388, 591
BssMI	GATC	7 cut(s)	83, 109, 220, 295, 408, 430, 595
BssNAI	GTATAC	1 cut(s)	441
BssT1I	CCWWGG	2 cut(s)	101, 591
Bst1107I	GTATAC	1 cut(s)	441
Bst2UI	CCWGG	2 cut(s)	339, 389
BstAFI	CTTAAG	1 cut(s)	625
BstAPI	GCANNNNNTGC	1 cut(s)	422
BstC8I	GCNNGC	2 cut(s)	354, 558
BstDEI	CTNAG	2 cut(s)	9, 606
BstDSI	CCRYGG	1 cut(s)	591
BstENI	CCTNNNNNAGG	1 cut(s)	320
BstF5I	GGATG	3 cut(s)	97, 267, 563
BstKTI	GATC	7 cut(s)	86, 112, 223, 298, 411, 433, 598
BstMBI	GATC	7 cut(s)	83, 109, 220, 295, 408, 430, 595
BstMWI	GCNNNNNNNGC	4 cut(s)	422, 545, 566, 575
BstNI	CCWGG	2 cut(s)	339, 389
BstSCI	CCNGG	2 cut(s)	337, 387
BstSFI	CTRYAG	1 cut(s)	126
BstV1I	GCAGC	1 cut(s)	79
BstV2I	GAAGAC	3 cut(s)	206, 294, 513
BstX2I	RGATCY	1 cut(s)	595
BstYI	RGATCY	1 cut(s)	595
BstZ17I	GTATAC	1 cut(s)	441
BtgI	CCRYGG	1 cut(s)	591
BtsCI	GGATG	3 cut(s)	97, 267, 563
Cac8I	GCNNGC	2 cut(s)	354, 558
CaiI	CAGNNNCTG	1 cut(s)	92
Cfr13I	GGNCC	1 cut(s)	122
Csp6I	GTAC	3 cut(s)	232, 586, 610
CviAII	CATG	2 cut(s)	319, 592
CviJI	RGCY	4 cut(s)	131, 264, 362, 578
CviKI_1	RGCY	4 cut(s)	131, 264, 362, 578
CviQI	GTAC	3 cut(s)	232, 586, 610
DdeI	CTNAG	2 cut(s)	9, 606
DpnI	GATC	7 cut(s)	85, 111, 222, 297, 410, 432, 597
DpnII	GATC	7 cut(s)	83, 109, 220, 295, 408, 430, 595
DraIII	CACNNNGTG	1 cut(s)	282
Eco130I	CCWWGG	2 cut(s)	101, 591
Eco47I	GGWCC	1 cut(s)	122
EcoNI	CCTNNNNNAGG	1 cut(s)	320
EcoRII	CCWGG	2 cut(s)	337, 387
EcoT14I	CCWWGG	2 cut(s)	101, 591
ErhI	CCWWGG	2 cut(s)	101, 591
FaeI	CATG	2 cut(s)	322, 595
FatI	CATG	2 cut(s)	318, 591
FblI	GTMKAC	1 cut(s)	440
Fnu4HI	GCNGC	1 cut(s)	93
FokI	GGATG	3 cut(s)	84, 254, 550
Fsp4HI	GCNGC	1 cut(s)	93
FspBI	CTAG	1 cut(s)	311
GluI	GCNGC	1 cut(s)	93
Hin1II	CATG	2 cut(s)	322, 595
HincII	GTYRAC	1 cut(s)	544
HindII	GTYRAC	1 cut(s)	544
HinfI	GANTC	1 cut(s)	61
HpaI	GTTAAC	1 cut(s)	544
HphI	GGTGA	1 cut(s)	467
Hpy166II	GTNNAC	2 cut(s)	441, 544
Hpy188I	TCNGA	3 cut(s)	10, 225, 487
Hpy188III	TCNNGA	3 cut(s)	113, 434, 572
Hpy8I	GTNNAC	2 cut(s)	441, 544
Hpy99I	CGWCG	1 cut(s)	498
HpyAV	CCTTC	1 cut(s)	344
HpyCH4V	TGCA	4 cut(s)	95, 322, 416, 619
HpyF10VI	GCNNNNNNNGC	4 cut(s)	422, 545, 566, 575
HpyF3I	CTNAG	2 cut(s)	9, 606
Hsp92II	CATG	2 cut(s)	322, 595
KspAI	GTTAAC	1 cut(s)	544
Kzo9I	GATC	7 cut(s)	83, 109, 220, 295, 408, 430, 595
Lsp1109I	GCAGC	1 cut(s)	79
LweI	GCATC	1 cut(s)	363
MaeI	CTAG	1 cut(s)	311
MalI	GATC	7 cut(s)	85, 111, 222, 297, 410, 432, 597
MbiI	CCGCTC	1 cut(s)	569
MboI	GATC	7 cut(s)	83, 109, 220, 295, 408, 430, 595
MboII	GAAGA	3 cut(s)	211, 299, 518
MflI	RGATCY	1 cut(s)	595
MluCI	AATT	2 cut(s)	117, 210
MnlI	CCTC	7 cut(s)	4, 51, 261, 282, 326, 483, 526
MseI	TTAA	5 cut(s)	50, 209, 213, 543, 626
MslI	CAYNNNNRTG	2 cut(s)	258, 368
MspCI	CTTAAG	1 cut(s)	625
MspR9I	CCNGG	2 cut(s)	339, 389
MvaI	CCWGG	2 cut(s)	339, 389
MwoI	GCNNNNNNNGC	4 cut(s)	422, 545, 566, 575
NcoI	CCATGG	1 cut(s)	591
NdeII	GATC	7 cut(s)	83, 109, 220, 295, 408, 430, 595
NlaIII	CATG	2 cut(s)	322, 595
NlaIV	GGNNCC	1 cut(s)	327
PacI	TTAATTAA	1 cut(s)	213
PfeI	GAWTC	1 cut(s)	61
PkrI	GCNGC	1 cut(s)	94
PshBI	ATTAAT	1 cut(s)	209
Psp6I	CCWGG	2 cut(s)	337, 387
PspGI	CCWGG	2 cut(s)	337, 387
PspN4I	GGNNCC	1 cut(s)	327
PspPI	GGNCC	1 cut(s)	122
PstNI	CAGNNNCTG	1 cut(s)	92
PsuI	RGATCY	1 cut(s)	595
RsaI	GTAC	3 cut(s)	233, 587, 611
RsaNI	GTAC	3 cut(s)	232, 586, 610
RseI	CAYNNNNRTG	2 cut(s)	258, 368
SaqAI	TTAA	5 cut(s)	50, 209, 213, 543, 626
SatI	GCNGC	1 cut(s)	93
Sau3AI	GATC	7 cut(s)	83, 109, 220, 295, 408, 430, 595
Sau96I	GGNCC	1 cut(s)	122
ScaI	AGTACT	1 cut(s)	587
ScrFI	CCNGG	2 cut(s)	339, 389
SetI	ASST	7 cut(s)	219, 281, 331, 468, 537, 580, 626
SfaNI	GCATC	1 cut(s)	363
SfcI	CTRYAG	1 cut(s)	126
SinI	GGWCC	1 cut(s)	122
SmiMI	CAYNNNNRTG	2 cut(s)	258, 368
SmlI	CTYRAG	1 cut(s)	625
SmoI	CTYRAG	1 cut(s)	625
Sse9I	AATT	2 cut(s)	117, 210
SsiI	CCGC	4 cut(s)	478, 539, 567, 631
SspMI	CTAG	1 cut(s)	311
StyD4I	CCNGG	2 cut(s)	337, 387
StyI	CCWWGG	2 cut(s)	101, 591
TasI	AATT	2 cut(s)	117, 210
TatI	WGTACW	3 cut(s)	231, 585, 609
TfiI	GAWTC	1 cut(s)	61
Tru1I	TTAA	5 cut(s)	50, 209, 213, 543, 626
Tru9I	TTAA	5 cut(s)	50, 209, 213, 543, 626
TseI	GCWGC	1 cut(s)	92
TspDTI	ATGAA	3 cut(s)	36, 57, 256
TspGWI	ACGGA	1 cut(s)	482
Vha464I	CTTAAG	1 cut(s)	625
VpaK11BI	GGWCC	1 cut(s)	122
VspI	ATTAAT	1 cut(s)	209
XagI	CCTNNNNNAGG	1 cut(s)	320
XmiI	GTMKAC	1 cut(s)	440
XspI	CTAG	1 cut(s)	311
ZrmI	AGTACT	1 cut(s)	587

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.