Prupe.3G165100_v2.0.a1

helix loop helix domain

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp03
Physical Location & Seq
Reverse (-)
18418335 .. 18418753
419 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.3G165100.1

Sequence Viewer

Length: 120 bp
ATGTTTTCAACATTGATAAAATCTAAACTGGTCTTCTTTAATTTACATCTTCAGATCGAAAGAAGTTATAGATTAGAATGTGAGAATTTAAGCGAGAAGCTCATGTCCTTCTATGCCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

40

Amino Acids

4.73

Weight (kDa)

7.92

Isoelectric Point (pI)

71.67

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 85
AcuI CTGAAG 1 cut(s) 35
AgsI TTSAA 1 cut(s) 9
AluBI AGCT 1 cut(s) 100
AluI AGCT 1 cut(s) 100
ApoI RAATTY 1 cut(s) 85
BbsI GAAGAC 1 cut(s) 25
BpiI GAAGAC 1 cut(s) 25
Bse1I ACTGG 1 cut(s) 33
BseNI ACTGG 1 cut(s) 33
Bsp143I GATC 1 cut(s) 54
BsrI ACTGG 1 cut(s) 33
BssMI GATC 1 cut(s) 54
BstKTI GATC 1 cut(s) 57
BstMBI GATC 1 cut(s) 54
BstV2I GAAGAC 1 cut(s) 25
CviAII CATG 1 cut(s) 103
CviJI RGCY 1 cut(s) 100
CviKI_1 RGCY 1 cut(s) 100
DpnI GATC 1 cut(s) 56
DpnII GATC 1 cut(s) 54
Eco57I CTGAAG 1 cut(s) 35
FaeI CATG 1 cut(s) 106
FaiI YATR 3 cut(s) 69, 104, 114
FatI CATG 1 cut(s) 102
FspEI CC 1 cut(s) 14
Hin1II CATG 1 cut(s) 106
Hpy188I TCNGA 1 cut(s) 54
HpyAV CCTTC 1 cut(s) 118
Hsp92II CATG 1 cut(s) 106
Kzo9I GATC 1 cut(s) 54
LpnPI CCDG 1 cut(s) 14
MalI GATC 1 cut(s) 56
MboI GATC 1 cut(s) 54
MboII GAAGA 2 cut(s) 25, 41
MluCI AATT 2 cut(s) 40, 85
MseI TTAA 2 cut(s) 39, 89
NdeII GATC 1 cut(s) 54
NlaIII CATG 1 cut(s) 106
SaqAI TTAA 2 cut(s) 39, 89
Sau3AI GATC 1 cut(s) 54
SetI ASST 1 cut(s) 102
SgeI CNNG 3 cut(s) 41, 106, 115
Sse9I AATT 2 cut(s) 40, 85
TaqI TCGA 1 cut(s) 57
TasI AATT 2 cut(s) 40, 85
Tru1I TTAA 2 cut(s) 39, 89
Tru9I TTAA 2 cut(s) 39, 89
XapI RAATTY 1 cut(s) 85
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.