Prupe.6G166600_v2.0.a1

transposition, RNA-mediated

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp06
OG0006403
Physical Location & Seq
Forward (+)
16891105 .. 16891422
318 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.6G166600.1

Sequence Viewer

Length: 318 bp
ATGGAAAAGGGAAGTTCCTCTAATATTATCTTCATGCTTGTGTTCGACCAGCTCAGAATAAATCGAGCGCTCCTAGACAAAAGAATGCCCCCGATTTATGCCTTTGAAGGAACTCAAGTACAACCCCTAGGCAATATCCATATCACCCTAACCATAGGAGAATGTCCAAACCAGGCGACCACGGTCACCAACTTTGTCATAGTGGATTGTTCGACCACTTACAACGTAGTCTTGGGCCAACCAACGTTCACGGAGCTCGATGTTACCATCAGTTACCGCACCCTCATGCTAAAGTTCACGAATGCTCATGGAATATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
RVT_1 RVT_3

Protein Analysis

106

Amino Acids

11.74

Weight (kDa)

6.02

Isoelectric Point (pI)

35.11

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 277
AclI AACGTT 1 cut(s) 245
AfaI GTAC 1 cut(s) 120
AfeI AGCGCT 1 cut(s) 69
AgsI TTSAA 1 cut(s) 107
AjnI CCWGG 1 cut(s) 171
AluBI AGCT 2 cut(s) 52, 256
AluI AGCT 2 cut(s) 52, 256
Alw21I GWGCWC 1 cut(s) 258
Aor51HI AGCGCT 1 cut(s) 69
AoxI GGCC 1 cut(s) 235
AspA2I CCTAGG 1 cut(s) 127
AspLEI GCGC 1 cut(s) 70
AspS9I GGNCC 1 cut(s) 235
AsuHPI GGTGA 2 cut(s) 136, 178
AvrII CCTAGG 1 cut(s) 127
BanII GRGCYC 1 cut(s) 258
Bbv12I GWGCWC 1 cut(s) 258
BccI CCATC 1 cut(s) 275
BciT130I CCWGG 1 cut(s) 173
BfaI CTAG 2 cut(s) 74, 128
BfoI RGCGCY 1 cut(s) 71
BlnI CCTAGG 1 cut(s) 127
Bme1390I CCNGG 1 cut(s) 173
BmgT120I GGNCC 1 cut(s) 235
BmrFI CCNGG 1 cut(s) 173
BoxI GACNNNNGTC 1 cut(s) 182
BpuEI CTTGAG 1 cut(s) 99
BsaJI CCNNGG 2 cut(s) 127, 180
BseBI CCWGG 1 cut(s) 173
BseDI CCNNGG 2 cut(s) 127, 180
BseMII CTCAG 1 cut(s) 67
BshFI GGCC 1 cut(s) 237
BsiHKAI GWGCWC 1 cut(s) 258
BsmI GAATGC 2 cut(s) 90, 307
BsnI GGCC 1 cut(s) 237
Bsp1286I GDGCHC 1 cut(s) 258
BspACI CCGC 1 cut(s) 277
BspANI GGCC 1 cut(s) 237
BspCNI CTCAG 1 cut(s) 66
BssECI CCNNGG 2 cut(s) 127, 180
BssT1I CCWWGG 1 cut(s) 127
Bst2UI CCWGG 1 cut(s) 173
Bst4CI ACNGT 1 cut(s) 184
BstDEI CTNAG 1 cut(s) 53
BstDSI CCRYGG 1 cut(s) 180
BstEII GGTNACC 1 cut(s) 184
BstH2I RGCGCY 1 cut(s) 71
BstHHI GCGC 1 cut(s) 70
BstNI CCWGG 1 cut(s) 173
BstPAI GACNNNNGTC 1 cut(s) 182
BstPI GGTNACC 1 cut(s) 184
BstSCI CCNGG 1 cut(s) 171
BsuRI GGCC 1 cut(s) 237
BtgI CCRYGG 1 cut(s) 180
CfoI GCGC 1 cut(s) 70
Cfr13I GGNCC 1 cut(s) 235
Csp6I GTAC 1 cut(s) 119
CviAII CATG 3 cut(s) 34, 286, 308
CviJI RGCY 3 cut(s) 52, 237, 256
CviKI_1 RGCY 3 cut(s) 52, 237, 256
CviQI GTAC 1 cut(s) 119
DdeI CTNAG 1 cut(s) 53
Ecl136II GAGCTC 1 cut(s) 256
Eco130I CCWWGG 1 cut(s) 127
Eco24I GRGCYC 1 cut(s) 258
Eco47III AGCGCT 1 cut(s) 69
Eco53kI GAGCTC 1 cut(s) 256
Eco91I GGTNACC 1 cut(s) 184
EcoICRI GAGCTC 1 cut(s) 256
EcoO65I GGTNACC 1 cut(s) 184
EcoRII CCWGG 1 cut(s) 171
EcoT14I CCWWGG 1 cut(s) 127
EcoT38I GRGCYC 1 cut(s) 258
ErhI CCWWGG 1 cut(s) 127
FaeI CATG 3 cut(s) 37, 289, 311
FaiI YATR 8 cut(s) 35, 99, 141, 155, 200, 287, 309, 316
FatI CATG 3 cut(s) 33, 285, 307
FriOI GRGCYC 1 cut(s) 258
FspBI CTAG 2 cut(s) 74, 128
GlaI GCGC 1 cut(s) 69
HaeII RGCGCY 1 cut(s) 71
HaeIII GGCC 1 cut(s) 237
HhaI GCGC 1 cut(s) 70
Hin1II CATG 3 cut(s) 37, 289, 311
Hin6I GCGC 1 cut(s) 68
HinP1I GCGC 1 cut(s) 68
HphI GGTGA 2 cut(s) 136, 178
Hpy166II GTNNAC 2 cut(s) 249, 297
Hpy188I TCNGA 1 cut(s) 56
Hpy188III TCNNGA 1 cut(s) 298
Hpy8I GTNNAC 2 cut(s) 249, 297
HpyAV CCTTC 1 cut(s) 101
HpyCH4III ACNGT 1 cut(s) 184
HpyCH4IV ACGT 2 cut(s) 225, 245
HpyF3I CTNAG 1 cut(s) 53
HpySE526I ACGT 2 cut(s) 225, 245
Hsp92II CATG 3 cut(s) 37, 289, 311
HspAI GCGC 1 cut(s) 68
LmnI GCTCC 2 cut(s) 75, 253
LpnPI CCDG 3 cut(s) 62, 158, 185
MaeI CTAG 2 cut(s) 74, 128
MaeII ACGT 2 cut(s) 225, 245
MaeIII GTNAC 3 cut(s) 184, 262, 272
MboII GAAGA 1 cut(s) 22
MhlI GDGCHC 1 cut(s) 258
MnlI CCTC 2 cut(s) 28, 293
MslI CAYNNNNRTG 2 cut(s) 38, 284
MspR9I CCNGG 1 cut(s) 173
Mva1269I GAATGC 2 cut(s) 90, 307
MvaI CCWGG 1 cut(s) 173
NlaIII CATG 3 cut(s) 37, 289, 311
NmuCI GTSAC 1 cut(s) 184
PctI GAATGC 2 cut(s) 90, 307
PshAI GACNNNNGTC 1 cut(s) 182
Psp124BI GAGCTC 1 cut(s) 258
Psp1406I AACGTT 1 cut(s) 245
Psp6I CCWGG 1 cut(s) 171
PspEI GGTNACC 1 cut(s) 184
PspGI CCWGG 1 cut(s) 171
PspPI GGNCC 1 cut(s) 235
RsaI GTAC 1 cut(s) 120
RsaNI GTAC 1 cut(s) 119
RseI CAYNNNNRTG 2 cut(s) 38, 284
SacI GAGCTC 1 cut(s) 258
Sau96I GGNCC 1 cut(s) 235
ScrFI CCNGG 1 cut(s) 173
SduI GDGCHC 1 cut(s) 258
SetI ASST 4 cut(s) 54, 228, 248, 258
SmiMI CAYNNNNRTG 2 cut(s) 38, 284
SmlI CTYRAG 1 cut(s) 114
SmoI CTYRAG 1 cut(s) 114
SsiI CCGC 1 cut(s) 277
SspI AATATT 1 cut(s) 25
SspMI CTAG 2 cut(s) 74, 128
SstI GAGCTC 1 cut(s) 258
StyD4I CCNGG 1 cut(s) 171
StyI CCWWGG 1 cut(s) 127
TaaI ACNGT 1 cut(s) 184
TaiI ACGT 2 cut(s) 228, 248
TaqI TCGA 4 cut(s) 45, 64, 212, 258
TatI WGTACW 1 cut(s) 118
TseFI GTSAC 1 cut(s) 184
Tsp45I GTSAC 1 cut(s) 184
TspDTI ATGAA 1 cut(s) 22
TspGWI ACGGA 1 cut(s) 266
XmaJI CCTAGG 1 cut(s) 127
XspI CTAG 2 cut(s) 74, 128
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.