Rmu_sc0000145.1_g000003

transposition, RNA-mediated

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000145.1
Physical Location & Seq
Reverse (-)
40197 .. 40505
309 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000145.1_g000003.1.cds

Sequence Viewer

Length: 309 bp
atgcatgaaatcttggctattcatgggaggccactttcctccggggaggaggaaacaaggctattatctgaaatcaagcaggccgagaaaattaggagagtgtgcaaggttgaaaaagaagtaaatgtggaggcactatggtacaacgaactagtgataagcttctccaagcaaattgcaatctgggtgcaattcccgcaccgaaacgcattagtgatctccatacaggtcgctaactgtctcatgggaagggtaatactggacgaaggaagcaaggctgaagtgatattccttggtgccttcaaatag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

102

Amino Acids

11.62

Weight (kDa)

6.83

Isoelectric Point (pI)

44.74

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 296
AciI CCGC 1 cut(s) 197
AcuI CTGAAG 1 cut(s) 300
AfaI GTAC 1 cut(s) 143
AgsI TTSAA 2 cut(s) 113, 304
AhlI ACTAGT 1 cut(s) 151
AluBI AGCT 1 cut(s) 162
AluI AGCT 1 cut(s) 162
Alw26I GTCTC 1 cut(s) 245
AoxI GGCC 2 cut(s) 29, 81
AsuC2I CCSGG 1 cut(s) 43
BanI GGYRCC 1 cut(s) 296
BcnI CCSGG 1 cut(s) 43
BcoDI GTCTC 1 cut(s) 245
BcuI ACTAGT 1 cut(s) 151
BfaI CTAG 1 cut(s) 152
Bme1390I CCNGG 1 cut(s) 43
BmiI GGNNCC 1 cut(s) 298
BmrFI CCNGG 1 cut(s) 43
BpuMI CCSGG 1 cut(s) 43
BsaJI CCNNGG 2 cut(s) 42, 292
Bse1I ACTGG 1 cut(s) 264
BseDI CCNNGG 2 cut(s) 42, 292
BseNI ACTGG 1 cut(s) 264
BseRI GAGGAG 1 cut(s) 62
BshFI GGCC 2 cut(s) 31, 83
BshNI GGYRCC 1 cut(s) 296
BsiSI CCGG 1 cut(s) 42
BsmAI GTCTC 1 cut(s) 245
BsnI GGCC 2 cut(s) 31, 83
Bsp143I GATC 1 cut(s) 216
BspACI CCGC 1 cut(s) 197
BspANI GGCC 2 cut(s) 31, 83
BspLI GGNNCC 1 cut(s) 298
BspT107I GGYRCC 1 cut(s) 296
BsrI ACTGG 1 cut(s) 264
BssECI CCNNGG 2 cut(s) 42, 292
BssMI GATC 1 cut(s) 216
BssT1I CCWWGG 1 cut(s) 292
Bst4CI ACNGT 1 cut(s) 239
BstC8I GCNNGC 1 cut(s) 81
BstKTI GATC 1 cut(s) 219
BstMAI GTCTC 1 cut(s) 245
BstMBI GATC 1 cut(s) 216
BstMWI GCNNNNNNNGC 1 cut(s) 196
BstSCI CCNGG 1 cut(s) 41
BsuRI GGCC 2 cut(s) 31, 83
Cac8I GCNNGC 1 cut(s) 81
Csp6I GTAC 1 cut(s) 142
CviAII CATG 3 cut(s) 5, 23, 244
CviJI RGCY 6 cut(s) 17, 31, 61, 83, 162, 278
CviKI_1 RGCY 6 cut(s) 17, 31, 61, 83, 162, 278
CviQI GTAC 1 cut(s) 142
DpnI GATC 1 cut(s) 218
DpnII GATC 1 cut(s) 216
Eco130I CCWWGG 1 cut(s) 292
Eco57I CTGAAG 1 cut(s) 300
EcoT14I CCWWGG 1 cut(s) 292
EcoT22I ATGCAT 1 cut(s) 6
ErhI CCWWGG 1 cut(s) 292
FaeI CATG 3 cut(s) 8, 26, 247
FaiI YATR 5 cut(s) 6, 24, 139, 224, 245
FatI CATG 3 cut(s) 4, 22, 243
FauI CCCGC 1 cut(s) 204
FspBI CTAG 1 cut(s) 152
HaeIII GGCC 2 cut(s) 31, 83
HapII CCGG 1 cut(s) 42
Hin1II CATG 3 cut(s) 8, 26, 247
HindIII AAGCTT 1 cut(s) 160
HpaII CCGG 1 cut(s) 42
Hpy188I TCNGA 1 cut(s) 70
HpyAV CCTTC 2 cut(s) 243, 260
HpyCH4III ACNGT 1 cut(s) 239
HpyCH4V TGCA 4 cut(s) 4, 105, 179, 190
HpyF10VI GCNNNNNNNGC 1 cut(s) 196
Hsp92II CATG 3 cut(s) 8, 26, 247
Kzo9I GATC 1 cut(s) 216
LpnPI CCDG 5 cut(s) 55, 65, 169, 212, 245
MaeI CTAG 1 cut(s) 152
MalI GATC 1 cut(s) 218
MboI GATC 1 cut(s) 216
MluCI AATT 3 cut(s) 90, 174, 191
MnlI CCTC 5 cut(s) 21, 40, 43, 49, 124
Mph1103I ATGCAT 1 cut(s) 6
MspI CCGG 1 cut(s) 42
MspR9I CCNGG 1 cut(s) 43
MwoI GCNNNNNNNGC 1 cut(s) 196
NciI CCSGG 1 cut(s) 43
NdeII GATC 1 cut(s) 216
NlaIII CATG 3 cut(s) 8, 26, 247
NlaIV GGNNCC 1 cut(s) 298
NmeAIII GCCGAG 1 cut(s) 109
NsiI ATGCAT 1 cut(s) 6
PspN4I GGNNCC 1 cut(s) 298
RsaI GTAC 1 cut(s) 143
RsaNI GTAC 1 cut(s) 142
Sau3AI GATC 1 cut(s) 216
ScrFI CCNGG 1 cut(s) 43
SetI ASST 3 cut(s) 111, 164, 231
SpeI ACTAGT 1 cut(s) 151
Sse9I AATT 3 cut(s) 90, 174, 191
SsiI CCGC 1 cut(s) 197
SspMI CTAG 1 cut(s) 152
StyD4I CCNGG 1 cut(s) 41
StyI CCWWGG 1 cut(s) 292
TaaI ACNGT 1 cut(s) 239
TasI AATT 3 cut(s) 90, 174, 191
TspDTI ATGAA 2 cut(s) 11, 21
XspI CTAG 1 cut(s) 152
Zsp2I ATGCAT 1 cut(s) 6
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.