Basic Information

Type: gene

Biological Identity

Species

pyrus_communis

Chromosome

Chr13

Orthogroup ID

OG0006403

Physical Location & Seq

Genomic Coordinates Forward (+)

4076970 .. 4077284

Gene Structure 315 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

pycom13g06290.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 315 bp

ATGCGATCCAAATTTATCACAAATATACGAACACCTAGGGCCACCAGCAATTCCAAGAAAAGGAAGATCCAGCAGGCGAGATCGGTTTTCCCGGTTCAAACTGTCGATGCTATACCAGGGCCGATCATCGGCTTTACGGAGCAAGACGCCGAACGAGTAGACTTCTCCCATGACGACGTCCTAGTAATCTATGTCCAATTGGGCATGGTCGGTACAGTGATGGTGGATAATGGCAGCAAAGTCAACATTCTTCAATTTTCCATGATCAAAAGTTGGGCTTCAAGAGCAAAATCAGACGCCGGAAGGAGGTCTTGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

RVT_1 RVT_3 rve

Protein Analysis

105

Amino Acids

11.6

Weight (kDa)

10.41

Isoelectric Point (pI)

41.69

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0006403)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_4g05724 FvH4_4g22761 FvH4_4g22761 FvH4_4g22761 FvH4_4g22761
prunus_persica	Prupe.1G216400_v2.0.a1 Prupe.6G166600_v2.0.a1
pyrus_communis	pycom13g06290 pycom16g14440
rosa_laevigata	RLG00000007107
rosa_multiflora	Rmu_sc0000145.1_g000003 Rmu_sc0000588.1_g000009
rosa_roxburghii	Rroxscaffold_3G00242120 Rroxscaffold_3G00242200 Rroxscaffold_3G00251940 Rroxscaffold_5G00346840
rosa_samantha	Rh4AG287800 Rh4BG293800 Rh4CG309400
rosa_wichuraiana	Rw0G009200 Rw1G013120 Rw1G021060 Rw2G026690 Rw2G028100 Rw2G038560 Rw6G016440 Rw7G015580

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AatII	GACGTC	1 cut(s)	180
AccI	GTMKAC	1 cut(s)	159
AclWI	GGATC	1 cut(s)	61
AcsI	RAATTY	1 cut(s)	11
AcyI	GRCGYC	3 cut(s)	147, 177, 297
AfaI	GTAC	1 cut(s)	214
AfiI	CCNNNNNNNGG	3 cut(s)	60, 128, 306
AgsI	TTSAA	3 cut(s)	98, 254, 282
AjnI	CCWGG	1 cut(s)	115
AlwI	GGATC	1 cut(s)	61
AoxI	GGCC	2 cut(s)	39, 119
ApeKI	GCWGC	1 cut(s)	234
ApoI	RAATTY	1 cut(s)	11
AspA2I	CCTAGG	1 cut(s)	35
AspS9I	GGNCC	2 cut(s)	39, 119
AsuC2I	CCSGG	1 cut(s)	92
AvrII	CCTAGG	1 cut(s)	35
BbvI	GCAGC	1 cut(s)	246
BccI	CCATC	1 cut(s)	214
BciT130I	CCWGG	1 cut(s)	117
BclI	TGATCA	1 cut(s)	264
BcnI	CCSGG	1 cut(s)	92
BfaI	CTAG	2 cut(s)	36, 182
BisI	GCNGC	1 cut(s)	235
BlnI	CCTAGG	1 cut(s)	35
BlsI	GCNGC	1 cut(s)	236
Bme1390I	CCNGG	2 cut(s)	92, 117
BmgT120I	GGNCC	2 cut(s)	39, 119
BmrFI	CCNGG	2 cut(s)	92, 117
BmsI	GCATC	1 cut(s)	97
BpuMI	CCSGG	1 cut(s)	92
BsaHI	GRCGYC	3 cut(s)	147, 177, 297
BsaJI	CCNNGG	2 cut(s)	35, 116
Bsc4I	CCNNNNNNNGG	3 cut(s)	60, 128, 306
BseBI	CCWGG	1 cut(s)	117
BseDI	CCNNGG	2 cut(s)	35, 116
BseLI	CCNNNNNNNGG	3 cut(s)	60, 128, 306
BseXI	GCAGC	1 cut(s)	246
BshFI	GGCC	2 cut(s)	41, 121
BsiSI	CCGG	2 cut(s)	92, 300
BslI	CCNNNNNNNGG	3 cut(s)	60, 128, 306
BsnI	GGCC	2 cut(s)	41, 121
Bsp143I	GATC	5 cut(s)	5, 66, 80, 123, 264
BspANI	GGCC	2 cut(s)	41, 121
BspPI	GGATC	1 cut(s)	61
BssECI	CCNNGG	2 cut(s)	35, 116
BssMI	GATC	5 cut(s)	5, 66, 80, 123, 264
BssNI	GRCGYC	3 cut(s)	147, 177, 297
BssT1I	CCWWGG	1 cut(s)	35
Bst2UI	CCWGG	1 cut(s)	117
Bst4CI	ACNGT	2 cut(s)	103, 217
BstACI	GRCGYC	3 cut(s)	147, 177, 297
BstC8I	GCNNGC	1 cut(s)	75
BstKTI	GATC	5 cut(s)	8, 69, 83, 126, 267
BstMBI	GATC	5 cut(s)	5, 66, 80, 123, 264
BstMWI	GCNNNNNNNGC	1 cut(s)	284
BstNI	CCWGG	1 cut(s)	117
BstSCI	CCNGG	2 cut(s)	90, 115
BstV1I	GCAGC	1 cut(s)	246
BstX2I	RGATCY	1 cut(s)	66
BstYI	RGATCY	1 cut(s)	66
BsuRI	GGCC	2 cut(s)	41, 121
BtsIMutI	CAGTG	1 cut(s)	222
Cac8I	GCNNGC	1 cut(s)	75
Cfr13I	GGNCC	2 cut(s)	39, 119
CseI	GACGC	2 cut(s)	155, 305
Csp6I	GTAC	1 cut(s)	213
CviAII	CATG	3 cut(s)	170, 205, 262
CviJI	RGCY	4 cut(s)	41, 121, 132, 278
CviKI_1	RGCY	4 cut(s)	41, 121, 132, 278
CviQI	GTAC	1 cut(s)	213
DpnI	GATC	5 cut(s)	7, 68, 82, 125, 266
DpnII	GATC	5 cut(s)	5, 66, 80, 123, 264
Eco130I	CCWWGG	1 cut(s)	35
EcoRII	CCWGG	1 cut(s)	115
EcoT14I	CCWWGG	1 cut(s)	35
ErhI	CCWWGG	1 cut(s)	35
FaeI	CATG	3 cut(s)	173, 208, 265
FaiI	YATR	6 cut(s)	26, 113, 171, 192, 206, 263
FalI	AAGNNNNNCTT	3 cut(s)	262, 294, 295
FatI	CATG	3 cut(s)	169, 204, 261
FbaI	TGATCA	1 cut(s)	264
FblI	GTMKAC	1 cut(s)	159
Fnu4HI	GCNGC	1 cut(s)	235
Fsp4HI	GCNGC	1 cut(s)	235
FspBI	CTAG	2 cut(s)	36, 182
GluI	GCNGC	1 cut(s)	235
HaeIII	GGCC	2 cut(s)	41, 121
HapII	CCGG	2 cut(s)	92, 300
HgaI	GACGC	2 cut(s)	155, 305
Hin1I	GRCGYC	3 cut(s)	147, 177, 297
Hin1II	CATG	3 cut(s)	173, 208, 265
HincII	GTYRAC	1 cut(s)	244
HindII	GTYRAC	1 cut(s)	244
HpaII	CCGG	2 cut(s)	92, 300
Hpy166II	GTNNAC	2 cut(s)	160, 244
Hpy188I	TCNGA	1 cut(s)	295
Hpy188III	TCNNGA	2 cut(s)	282, 312
Hpy8I	GTNNAC	2 cut(s)	160, 244
Hpy99I	CGWCG	1 cut(s)	179
HpyAV	CCTTC	1 cut(s)	297
HpyCH4III	ACNGT	2 cut(s)	103, 217
HpyCH4IV	ACGT	1 cut(s)	177
HpyF10VI	GCNNNNNNNGC	1 cut(s)	284
HpySE526I	ACGT	1 cut(s)	177
Hsp92I	GRCGYC	3 cut(s)	147, 177, 297
Hsp92II	CATG	3 cut(s)	173, 208, 265
Ksp22I	TGATCA	1 cut(s)	264
Kzo9I	GATC	5 cut(s)	5, 66, 80, 123, 264
LmnI	GCTCC	1 cut(s)	139
LpnPI	CCDG	6 cut(s)	58, 59, 83, 102, 105, 129
Lsp1109I	GCAGC	1 cut(s)	246
LweI	GCATC	1 cut(s)	97
MaeI	CTAG	2 cut(s)	36, 182
MaeII	ACGT	1 cut(s)	177
MalI	GATC	5 cut(s)	7, 68, 82, 125, 266
MboI	GATC	5 cut(s)	5, 66, 80, 123, 264
MboII	GAAGA	2 cut(s)	76, 242
MfeI	CAATTG	1 cut(s)	197
MflI	RGATCY	1 cut(s)	66
MluCI	AATT	4 cut(s)	11, 49, 197, 254
MnlI	CCTC	1 cut(s)	300
MspI	CCGG	2 cut(s)	92, 300
MspR9I	CCNGG	2 cut(s)	92, 117
MunI	CAATTG	1 cut(s)	197
MvaI	CCWGG	1 cut(s)	117
MwoI	GCNNNNNNNGC	1 cut(s)	284
NciI	CCSGG	1 cut(s)	92
NdeII	GATC	5 cut(s)	5, 66, 80, 123, 264
NlaIII	CATG	3 cut(s)	173, 208, 265
PflFI	GACNNNGTC	1 cut(s)	176
PkrI	GCNGC	1 cut(s)	236
Psp6I	CCWGG	1 cut(s)	115
PspGI	CCWGG	1 cut(s)	115
PspPI	GGNCC	2 cut(s)	39, 119
PsuI	RGATCY	1 cut(s)	66
PsyI	GACNNNGTC	1 cut(s)	176
RsaI	GTAC	1 cut(s)	214
RsaNI	GTAC	1 cut(s)	213
SatI	GCNGC	1 cut(s)	235
Sau3AI	GATC	5 cut(s)	5, 66, 80, 123, 264
Sau96I	GGNCC	2 cut(s)	39, 119
ScrFI	CCNGG	2 cut(s)	92, 117
SetI	ASST	3 cut(s)	37, 180, 311
SfaNI	GCATC	1 cut(s)	97
Sse9I	AATT	4 cut(s)	11, 49, 197, 254
SspMI	CTAG	2 cut(s)	36, 182
StyD4I	CCNGG	2 cut(s)	90, 115
StyI	CCWWGG	1 cut(s)	35
TaaI	ACNGT	2 cut(s)	103, 217
TaiI	ACGT	1 cut(s)	180
TaqI	TCGA	1 cut(s)	105
TasI	AATT	4 cut(s)	11, 49, 197, 254
TscAI	CASTG	1 cut(s)	222
TseI	GCWGC	1 cut(s)	234
TspGWI	ACGGA	1 cut(s)	152
TspRI	CASTG	1 cut(s)	222
Tth111I	GACNNNGTC	1 cut(s)	176
XapI	RAATTY	1 cut(s)	11
XmaJI	CCTAGG	1 cut(s)	35
XmiI	GTMKAC	1 cut(s)	159
XspI	CTAG	2 cut(s)	36, 182
ZraI	GACGTC	1 cut(s)	178

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.