pycom01g24040

Zinc finger with UFM1-specific peptidase domain

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr1
OG0007168
Physical Location & Seq
Forward (+)
21115805 .. 21116560
756 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom01g24040.3

Sequence Viewer

Length: 441 bp
ATGGGTAAAACTAGTGATGAGAATTCAGGAAATAAGTTTACAAGGAAAAGCAAGGGTCATCAGGTTCTCATTGATTGGATTTGGAACTACTTTTCTGATAATAATTCTACCAAATCTGGCAATCATCAGGTCATTGTCAGTGACAAAACACCCTTGTACTTCCAACACGATGGACATTCGAGAATGATTGTTGGGATTCCAGTCAAGGGTCAATGTAATGGCGTGCAGCAACACAATCTCTTAATATTAGAGCCTGGCCATAGAATGGCAGATCTGGAAAGATTACTAAGAGAAAAGGTAGGATGGCAGAAGTTTGTAAAACGAGGGGTTCTGACACTGAAAAAGCCACAATACCAGTTGTGCTATATCGATCCTGGAATTGCAAGCGGGGAGGAAAAGGGGTTGCTTAAGACAATGGAAAGCGTCTTTCTTGAATTCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Peptidase_C78

Protein Analysis

147

Amino Acids

16.69

Weight (kDa)

9.25

Isoelectric Point (pI)

15.54

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 265
AciI CCGC 1 cut(s) 387
AclWI GGATC 1 cut(s) 365
AcoI YGGCCR 1 cut(s) 256
AcsI RAATTY 2 cut(s) 22, 434
AfaI GTAC 1 cut(s) 158
AfiI CCNNNNNNNGG 2 cut(s) 206, 265
AflII CTTAAG 1 cut(s) 407
AgsI TTSAA 1 cut(s) 434
AhlI ACTAGT 1 cut(s) 11
AjnI CCWGG 2 cut(s) 253, 373
AlwI GGATC 1 cut(s) 365
AoxI GGCC 1 cut(s) 256
ApeKI GCWGC 1 cut(s) 226
ApoI RAATTY 2 cut(s) 22, 434
BalI TGGCCA 1 cut(s) 258
BbvI GCAGC 1 cut(s) 238
BccI CCATC 2 cut(s) 164, 297
BciT130I CCWGG 2 cut(s) 255, 375
BcuI ACTAGT 1 cut(s) 11
BfaI CTAG 2 cut(s) 12, 439
BfrI CTTAAG 1 cut(s) 407
BglII AGATCT 1 cut(s) 271
BisI GCNGC 1 cut(s) 227
BlsI GCNGC 1 cut(s) 228
Bme1390I CCNGG 2 cut(s) 255, 375
BmrFI CCNGG 2 cut(s) 255, 375
Bsa29I ATCGAT 1 cut(s) 369
Bsc4I CCNNNNNNNGG 2 cut(s) 206, 265
Bse1I ACTGG 2 cut(s) 200, 355
BseBI CCWGG 2 cut(s) 255, 375
BseCI ATCGAT 1 cut(s) 369
BseGI GGATG 1 cut(s) 308
BseLI CCNNNNNNNGG 2 cut(s) 206, 265
BseNI ACTGG 2 cut(s) 200, 355
BseXI GCAGC 1 cut(s) 238
BsgI GTGCAG 1 cut(s) 245
BshFI GGCC 1 cut(s) 258
BshVI ATCGAT 1 cut(s) 369
BslI CCNNNNNNNGG 2 cut(s) 206, 265
BsnI GGCC 1 cut(s) 258
Bsp143I GATC 2 cut(s) 271, 370
BspACI CCGC 1 cut(s) 387
BspANI GGCC 1 cut(s) 258
BspDI ATCGAT 1 cut(s) 369
BspPI GGATC 1 cut(s) 365
BspTI CTTAAG 1 cut(s) 407
BsrI ACTGG 2 cut(s) 200, 355
BssMI GATC 2 cut(s) 271, 370
Bst2UI CCWGG 2 cut(s) 255, 375
BstAFI CTTAAG 1 cut(s) 407
BstC8I GCNNGC 2 cut(s) 224, 385
BstDEI CTNAG 1 cut(s) 287
BstF5I GGATG 1 cut(s) 308
BstKTI GATC 2 cut(s) 274, 373
BstMBI GATC 2 cut(s) 271, 370
BstNI CCWGG 2 cut(s) 255, 375
BstSCI CCNGG 2 cut(s) 253, 373
BstV1I GCAGC 1 cut(s) 238
BstX2I RGATCY 1 cut(s) 271
BstXI CCANNNNNNTGG 1 cut(s) 170
BstYI RGATCY 1 cut(s) 271
Bsu15I ATCGAT 1 cut(s) 369
BsuRI GGCC 1 cut(s) 258
BsuTUI ATCGAT 1 cut(s) 369
BtsCI GGATG 1 cut(s) 308
BtsIMutI CAGTG 2 cut(s) 145, 335
Cac8I GCNNGC 2 cut(s) 224, 385
ClaI ATCGAT 1 cut(s) 369
CseI GACGC 1 cut(s) 412
Csp6I GTAC 1 cut(s) 157
CviJI RGCY 3 cut(s) 253, 258, 346
CviKI_1 RGCY 3 cut(s) 253, 258, 346
CviQI GTAC 1 cut(s) 157
DdeI CTNAG 1 cut(s) 287
DpnI GATC 2 cut(s) 273, 372
DpnII GATC 2 cut(s) 271, 370
EaeI YGGCCR 1 cut(s) 256
EcoRI GAATTC 2 cut(s) 22, 434
EcoRII CCWGG 2 cut(s) 253, 373
FaiI YATR 2 cut(s) 261, 366
FauI CCCGC 1 cut(s) 380
Fnu4HI GCNGC 1 cut(s) 227
FokI GGATG 1 cut(s) 315
Fsp4HI GCNGC 1 cut(s) 227
FspBI CTAG 2 cut(s) 12, 439
GluI GCNGC 1 cut(s) 227
HaeIII GGCC 1 cut(s) 258
HgaI GACGC 1 cut(s) 412
HinfI GANTC 1 cut(s) 196
Hpy166II GTNNAC 1 cut(s) 39
Hpy188I TCNGA 2 cut(s) 97, 333
Hpy188III TCNNGA 4 cut(s) 27, 180, 275, 431
Hpy8I GTNNAC 1 cut(s) 39
HpyCH4V TGCA 2 cut(s) 226, 383
HpyF3I CTNAG 1 cut(s) 287
Kzo9I GATC 2 cut(s) 271, 370
Lsp1109I GCAGC 1 cut(s) 238
MaeI CTAG 2 cut(s) 12, 439
MaeIII GTNAC 1 cut(s) 140
MalI GATC 2 cut(s) 273, 372
MboI GATC 2 cut(s) 271, 370
MflI RGATCY 1 cut(s) 271
MlsI TGGCCA 1 cut(s) 258
MluCI AATT 4 cut(s) 22, 103, 378, 434
MluNI TGGCCA 1 cut(s) 258
MmeI TCCRAC 1 cut(s) 187
MnlI CCTC 2 cut(s) 317, 385
Mox20I TGGCCA 1 cut(s) 258
MscI TGGCCA 1 cut(s) 258
MseI TTAA 2 cut(s) 242, 408
Msp20I TGGCCA 1 cut(s) 258
MspCI CTTAAG 1 cut(s) 407
MspR9I CCNGG 2 cut(s) 255, 375
MvaI CCWGG 2 cut(s) 255, 375
NdeII GATC 2 cut(s) 271, 370
NmuCI GTSAC 1 cut(s) 140
PfeI GAWTC 1 cut(s) 196
PflMI CCANNNNNTGG 1 cut(s) 265
PfoI TCCNGGA 1 cut(s) 373
PkrI GCNGC 1 cut(s) 228
Psp6I CCWGG 2 cut(s) 253, 373
PspGI CCWGG 2 cut(s) 253, 373
PsuI RGATCY 1 cut(s) 271
RsaI GTAC 1 cut(s) 158
RsaNI GTAC 1 cut(s) 157
SaqAI TTAA 2 cut(s) 242, 408
SatI GCNGC 1 cut(s) 227
Sau3AI GATC 2 cut(s) 271, 370
ScrFI CCNGG 2 cut(s) 255, 375
SetI ASST 3 cut(s) 66, 132, 300
SmlI CTYRAG 1 cut(s) 407
SmoI CTYRAG 1 cut(s) 407
SpeI ACTAGT 1 cut(s) 11
Sse9I AATT 4 cut(s) 22, 103, 378, 434
SsiI CCGC 1 cut(s) 387
SspI AATATT 1 cut(s) 246
SspMI CTAG 2 cut(s) 12, 439
StyD4I CCNGG 2 cut(s) 253, 373
TaqI TCGA 2 cut(s) 179, 369
TasI AATT 4 cut(s) 22, 103, 378, 434
TatI WGTACW 1 cut(s) 156
TfiI GAWTC 1 cut(s) 196
Tru1I TTAA 2 cut(s) 242, 408
Tru9I TTAA 2 cut(s) 242, 408
TscAI CASTG 2 cut(s) 145, 342
TseFI GTSAC 1 cut(s) 140
TseI GCWGC 1 cut(s) 226
Tsp45I GTSAC 1 cut(s) 140
TspRI CASTG 2 cut(s) 145, 342
Van91I CCANNNNNTGG 1 cut(s) 265
Vha464I CTTAAG 1 cut(s) 407
XapI RAATTY 2 cut(s) 22, 434
XspI CTAG 2 cut(s) 12, 439
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.